chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60115-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All chromosome unknown open reading frame, human C5orf28 Reagents
CRO Services
Product recommended

All chromosome unknown open reading frame, human C5orf28 Reagents
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Ferret chromosome unknown open reading frame, human C5orf28 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone in Cloning Vector, Ferret FG60115-G
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, untagged FG60115-UT
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60115-ACG
chromosome unknown open reading frame, human C5orf28 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60115-ACGLN
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60115-ANG
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60115-ACR
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60115-ANR
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60115-CF
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60115-NF
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-His tag FG60115-NH
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-HA tag FG60115-CY
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-HA tag FG60115-NY
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, C-Myc tag FG60115-CM
chromosome unknown open reading frame, human C5orf28 cDNA ORF Clone, Ferret, N-Myc tag FG60115-NM
info info
添加购物车成功! 添加购物车失败!