HNRNPH1 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60099-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HNRNPH1 Reagents
CRO Services
Product recommended

All HNRNPH1 Reagents
HNRNPH1 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1350 bp
Description
Full length Clone DNA of Ferret heterogeneous nuclear ribonucleoprotein H1 (H) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPH1 Background Information
Full Name
heterogeneous nuclear ribonucleoprotein H1 (H)

HNRNPH1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
HNRNPH1 cDNA ORF Clone in Cloning Vector, Ferret FG60099-G
HNRNPH1 cDNA ORF Clone, Ferret, untagged FG60099-UT
HNRNPH1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60099-ACGLN
HNRNPH1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60099-ACG
HNRNPH1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60099-ANG
HNRNPH1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60099-ACR
HNRNPH1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60099-ANR
HNRNPH1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60099-CF
HNRNPH1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60099-NF
HNRNPH1 cDNA ORF Clone, Ferret, N-His tag FG60099-NH
HNRNPH1 cDNA ORF Clone, Ferret, C-HA tag FG60099-CY
HNRNPH1 cDNA ORF Clone, Ferret, N-HA tag FG60099-NY
HNRNPH1 cDNA ORF Clone, Ferret, C-Myc tag FG60099-CM
HNRNPH1 cDNA ORF Clone, Ferret, N-Myc tag FG60099-NM

HNRNPH1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPH1 cDNA ORF Clone in Cloning Vector, Human HG18897-U
HNRNPH1 cDNA ORF Clone, Human, untagged HG18897-UT
HNRNPH1 cDNA ORF Clone, Human, C-GFPSpark® tag HG18897-ACG
HNRNPH1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18897-ACGLN
HNRNPH1 cDNA ORF Clone, Human, N-GFPSpark® tag HG18897-ANG
HNRNPH1 cDNA ORF Clone, Human, C-OFPSpark® tag HG18897-ACR
HNRNPH1 cDNA ORF Clone, Human, N-OFPSpark® tag HG18897-ANR
HNRNPH1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18897-CF
HNRNPH1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18897-NF
HNRNPH1 cDNA ORF Clone, Human, C-His tag HG18897-CH
HNRNPH1 cDNA ORF Clone, Human, N-His tag HG18897-NH
HNRNPH1 cDNA ORF Clone, Human, C-HA tag HG18897-CY
HNRNPH1 cDNA ORF Clone, Human, N-HA tag HG18897-NY
HNRNPH1 cDNA ORF Clone, Human, C-Myc tag HG18897-CM
HNRNPH1 cDNA ORF Clone, Human, N-Myc tag HG18897-NM
info info
添加购物车成功! 添加购物车失败!