GRPEL1 cDNA ORF Clone, Ferret, untagged

Cat: FG60054-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GRPEL1 Reagents
CRO Services
Product recommended

All GRPEL1 Reagents
GRPEL1 cDNA ORF Clone, Ferret, untagged General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Ferret GrpE-like 1, mitochondrial (E. coli).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRPEL1 Background Information
Full Name
GrpE-like 1, mitochondrial (E. coli)

GRPEL1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Ferret FG60054-G
GRPEL1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60054-ACGLN
GRPEL1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60054-ACG
GRPEL1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60054-ANG
GRPEL1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60054-ACR
GRPEL1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60054-ANR
GRPEL1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60054-CF
GRPEL1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60054-NF
GRPEL1 cDNA ORF Clone, Ferret, C-His tag FG60054-CH
GRPEL1 cDNA ORF Clone, Ferret, N-His tag FG60054-NH
GRPEL1 cDNA ORF Clone, Ferret, C-HA tag FG60054-CY
GRPEL1 cDNA ORF Clone, Ferret, N-HA tag FG60054-NY
GRPEL1 cDNA ORF Clone, Ferret, C-Myc tag FG60054-CM
GRPEL1 cDNA ORF Clone, Ferret, N-Myc tag FG60054-NM

GRPEL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Rat RG84667-U
GRPEL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84667-ACGLN

GRPEL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Mouse MG53187-G
GRPEL1 cDNA ORF Clone, Mouse, untagged MG53187-UT
GRPEL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53187-ACGLN
GRPEL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53187-ACG
GRPEL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53187-ANG
GRPEL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53187-ACR
GRPEL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53187-ANR
GRPEL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53187-CF
GRPEL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53187-NF
GRPEL1 cDNA ORF Clone, Mouse, C-His tag MG53187-CH
GRPEL1 cDNA ORF Clone, Mouse, N-His tag MG53187-NH
GRPEL1 cDNA ORF Clone, Mouse, C-HA tag MG53187-CY
GRPEL1 cDNA ORF Clone, Mouse, N-HA tag MG53187-NY
GRPEL1 cDNA ORF Clone, Mouse, C-Myc tag MG53187-CM
GRPEL1 cDNA ORF Clone, Mouse, N-Myc tag MG53187-NM

GRPEL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Human HG14608-G
GRPEL1 cDNA ORF Clone, Human, untagged HG14608-UT
GRPEL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14608-ACG
GRPEL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14608-ACGLN
GRPEL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14608-ANG
GRPEL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14608-ACR
GRPEL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14608-ANR
GRPEL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14608-CF
GRPEL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14608-NF
GRPEL1 cDNA ORF Clone, Human, C-His tag HG14608-CH
GRPEL1 cDNA ORF Clone, Human, N-His tag HG14608-NH
GRPEL1 cDNA ORF Clone, Human, C-HA tag HG14608-CY
GRPEL1 cDNA ORF Clone, Human, N-HA tag HG14608-NY
GRPEL1 cDNA ORF Clone, Human, C-Myc tag HG14608-CM
GRPEL1 cDNA ORF Clone, Human, N-Myc tag HG14608-NM
GRPEL1 qPCR Primer Pairs, Human HP103242
info info
添加购物车成功! 添加购物车失败!