FECH cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60142-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FECH Reagents
CRO Services
Product recommended

All FECH Reagents
FECH cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Ferret ferrochelatase with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FECH Background Information
Full Name
ferrochelatase

FECH cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
FECH cDNA ORF Clone in Cloning Vector, Ferret FG60142-G
FECH cDNA ORF Clone, Ferret, untagged FG60142-UT
FECH Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60142-ACGLN
FECH cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60142-ACG
FECH cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60142-ANG
FECH cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60142-ACR
FECH cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60142-ANR
FECH cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60142-CF
FECH cDNA ORF Clone, Ferret, C-His tag FG60142-CH
FECH cDNA ORF Clone, Ferret, N-His tag FG60142-NH
FECH cDNA ORF Clone, Ferret, C-HA tag FG60142-CY
FECH cDNA ORF Clone, Ferret, N-HA tag FG60142-NY
FECH cDNA ORF Clone, Ferret, C-Myc tag FG60142-CM
FECH cDNA ORF Clone, Ferret, N-Myc tag FG60142-NM

FECH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FECH cDNA ORF Clone in Cloning Vector, Mouse MG52203-G
FECH cDNA ORF Clone, Mouse, untagged MG52203-UT
FECH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52203-ACG
FECH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52203-ACGLN
FECH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52203-ANG
FECH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52203-ACR
FECH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52203-ANR
FECH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52203-CF
FECH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52203-NF
FECH cDNA ORF Clone, Mouse, C-His tag MG52203-CH
FECH cDNA ORF Clone, Mouse, N-His tag MG52203-NH
FECH cDNA ORF Clone, Mouse, C-HA tag MG52203-CY
FECH cDNA ORF Clone, Mouse, N-HA tag MG52203-NY
FECH cDNA ORF Clone, Mouse, C-Myc tag MG52203-CM
FECH cDNA ORF Clone, Mouse, N-Myc tag MG52203-NM
FECH qPCR Primer Pairs, Mouse MP202076

FECH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FECH cDNA ORF Clone in Cloning Vector, Human HG17103-U
FECH cDNA ORF Clone, Human, untagged HG17103-UT
FECH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17103-ACGLN
FECH cDNA ORF Clone, Human, C-GFPSpark® tag HG17103-ACG
FECH cDNA ORF Clone, Human, N-GFPSpark® tag HG17103-ANG
FECH cDNA ORF Clone, Human, C-OFPSpark® tag HG17103-ACR
FECH cDNA ORF Clone, Human, N-OFPSpark® tag HG17103-ANR
FECH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17103-CF
FECH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17103-NF
FECH cDNA ORF Clone, Human, C-His tag HG17103-CH
FECH cDNA ORF Clone, Human, N-His tag HG17103-NH
FECH cDNA ORF Clone, Human, C-HA tag HG17103-CY
FECH cDNA ORF Clone, Human, N-HA tag HG17103-NY
FECH cDNA ORF Clone, Human, C-Myc tag HG17103-CM
FECH cDNA ORF Clone, Human, N-Myc tag HG17103-NM
info info
添加购物车成功! 添加购物车失败!