ENO1 cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60094-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENO1 Reagents
CRO Services
Product recommended

All ENO1 Reagents
ENO1 cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1305 bp
Description
Full length Clone DNA of Ferret enolase 1, (alpha) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENO1 Background Information
Full Name
enolase 1, (alpha)
References
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • ENO1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Rhesus CG90355-G
    ENO1 cDNA ORF Clone, Rhesus, untagged CG90355-UT
    ENO1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90355-ACG
    ENO1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90355-ACGLN
    ENO1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90355-ANG
    ENO1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90355-ACR
    ENO1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90355-ANR
    ENO1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90355-CF
    ENO1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90355-NF
    ENO1 cDNA ORF Clone, Rhesus, C-His tag CG90355-CH
    ENO1 cDNA ORF Clone, Rhesus, N-His tag CG90355-NH
    ENO1 cDNA ORF Clone, Rhesus, C-HA tag CG90355-CY
    ENO1 cDNA ORF Clone, Rhesus, N-HA tag CG90355-NY
    ENO1 cDNA ORF Clone, Rhesus, C-Myc tag CG90355-CM
    ENO1 cDNA ORF Clone, Rhesus, N-Myc tag CG90355-NM

    ENO1 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Ferret FG60094-G
    ENO1 cDNA ORF Clone, Ferret, untagged FG60094-UT
    ENO1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60094-ACG
    ENO1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60094-ACGLN
    ENO1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60094-ANG
    ENO1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60094-ACR
    ENO1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60094-ANR
    ENO1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60094-CF
    ENO1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60094-NF
    ENO1 cDNA ORF Clone, Ferret, C-His tag FG60094-CH
    ENO1 cDNA ORF Clone, Ferret, N-His tag FG60094-NH
    ENO1 cDNA ORF Clone, Ferret, N-HA tag FG60094-NY
    ENO1 cDNA ORF Clone, Ferret, C-Myc tag FG60094-CM
    ENO1 cDNA ORF Clone, Ferret, N-Myc tag FG60094-NM

    ENO1 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Rabbit TG65113-G
    ENO1 cDNA ORF Clone, Rabbit, untagged TG65113-UT
    ENO1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65113-ACG
    ENO1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65113-ACGLN
    ENO1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65113-ANG
    ENO1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65113-ACR
    ENO1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65113-ANR
    ENO1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65113-CF
    ENO1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65113-NF
    ENO1 cDNA ORF Clone, Rabbit, C-His tag TG65113-CH
    ENO1 cDNA ORF Clone, Rabbit, N-His tag TG65113-NH
    ENO1 cDNA ORF Clone, Rabbit, C-HA tag TG65113-CY
    ENO1 cDNA ORF Clone, Rabbit, N-HA tag TG65113-NY
    ENO1 cDNA ORF Clone, Rabbit, C-Myc tag TG65113-CM
    ENO1 cDNA ORF Clone, Rabbit, N-Myc tag TG65113-NM

    ENO1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Rat RG80578-G
    ENO1 cDNA ORF Clone, Rat, untagged RG80578-UT
    ENO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80578-ACGLN
    ENO1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80578-ACG
    ENO1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80578-ACR
    ENO1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80578-CF
    ENO1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80578-NF
    ENO1 cDNA ORF Clone, Rat, C-His tag RG80578-CH
    ENO1 cDNA ORF Clone, Rat, N-His tag RG80578-NH
    ENO1 cDNA ORF Clone, Rat, C-HA tag RG80578-CY
    ENO1 cDNA ORF Clone, Rat, N-HA tag RG80578-NY
    ENO1 cDNA ORF Clone, Rat, C-Myc tag RG80578-CM
    ENO1 cDNA ORF Clone, Rat, N-Myc tag RG80578-NM
    ENO1 qPCR Primer Pairs, Rat RP300542

    ENO1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Mouse MG52810-G
    ENO1 cDNA ORF Clone, Mouse, untagged MG52810-UT
    ENO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52810-ACG
    ENO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52810-ACGLN
    ENO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52810-ANG
    ENO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52810-ACR
    ENO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52810-ANR
    ENO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52810-CF
    ENO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52810-NF
    ENO1 cDNA ORF Clone, Mouse, C-His tag MG52810-CH
    ENO1 cDNA ORF Clone, Mouse, N-His tag MG52810-NH
    ENO1 cDNA ORF Clone, Mouse, C-HA tag MG52810-CY
    ENO1 cDNA ORF Clone, Mouse, N-HA tag MG52810-NY
    ENO1 cDNA ORF Clone, Mouse, C-Myc tag MG52810-CM
    ENO1 cDNA ORF Clone, Mouse, N-Myc tag MG52810-NM

    ENO1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENO1 cDNA ORF Clone in Cloning Vector, Human HG11554-M
    ENO1 cDNA ORF Clone, Human, untagged HG11554-UT
    ENO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11554-ACGLN
    ENO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11554-ACG
    ENO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11554-ANG
    ENO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11554-ACR
    ENO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11554-CF
    ENO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11554-NF
    ENO1 cDNA ORF Clone, Human, C-His tag HG11554-CH
    ENO1 cDNA ORF Clone, Human, N-His tag HG11554-NH
    ENO1 cDNA ORF Clone, Human, C-HA tag HG11554-CY
    ENO1 cDNA ORF Clone, Human, N-HA tag HG11554-NY
    ENO1 cDNA ORF Clone, Human, C-Myc tag HG11554-CM
    ENO1 cDNA ORF Clone, Human, N-Myc tag HG11554-NM
    ENO1 qPCR Primer Pairs, Human HP101421
    info info
    添加购物车成功! 添加购物车失败!