EIF2S3 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60116-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF2S3 Reagents
CRO Services
Product recommended

All EIF2S3 Reagents
EIF2S3 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1419 bp
Description
Full length Clone DNA of Ferret eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF2S3 Background Information
Full Name
eukaryotic translation initiation factor 2 subunit gamma

EIF2S3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
EIF2S3 cDNA ORF Clone in Cloning Vector, Ferret FG60116-G
EIF2S3 cDNA ORF Clone, Ferret, untagged FG60116-UT
EIF2S3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60116-ACGLN
EIF2S3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60116-ACG
EIF2S3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60116-ANG
EIF2S3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60116-ACR
EIF2S3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60116-ANR
EIF2S3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60116-CF
EIF2S3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60116-NF
EIF2S3 cDNA ORF Clone, Ferret, N-His tag FG60116-NH
EIF2S3 cDNA ORF Clone, Ferret, C-HA tag FG60116-CY
EIF2S3 cDNA ORF Clone, Ferret, N-HA tag FG60116-NY
EIF2S3 cDNA ORF Clone, Ferret, C-Myc tag FG60116-CM
EIF2S3 cDNA ORF Clone, Ferret, N-Myc tag FG60116-NM

EIF2S3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF2S3 cDNA ORF Clone in Cloning Vector, Human HG12384-U
EIF2S3 cDNA ORF Clone, Human, untagged HG12384-UT
EIF2S3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12384-ACGLN
EIF2S3 cDNA ORF Clone, Human, C-GFPSpark® tag HG12384-ACG
EIF2S3 cDNA ORF Clone, Human, N-GFPSpark® tag HG12384-ANG
EIF2S3 cDNA ORF Clone, Human, C-OFPSpark® tag HG12384-ACR
EIF2S3 cDNA ORF Clone, Human, N-OFPSpark® tag HG12384-ANR
EIF2S3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12384-CF
EIF2S3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12384-NF
EIF2S3 cDNA ORF Clone, Human, C-His tag HG12384-CH
EIF2S3 cDNA ORF Clone, Human, N-His tag HG12384-NH
EIF2S3 cDNA ORF Clone, Human, C-HA tag HG12384-CY
EIF2S3 cDNA ORF Clone, Human, N-HA tag HG12384-NY
EIF2S3 cDNA ORF Clone, Human, C-Myc tag HG12384-CM
EIF2S3 cDNA ORF Clone, Human, N-Myc tag HG12384-NM
EIF2S3 qPCR Primer Pairs, Human HP104744
info info
添加购物车成功! 添加购物车失败!