eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-His tag

Cat: FG60129-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All eIF2A/eIF2 alpha Reagents
CRO Services
Product recommended

All eIF2A/eIF2 alpha Reagents
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Ferret eukaryotic translation initiation factor 2A, 65kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2A/eIF2 alpha Background Information
Full Name
eukaryotic translation initiation factor 2A, 65kDa

eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone in Cloning Vector, Ferret FG60129-G
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, untagged FG60129-UT
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60129-ACG
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60129-ACGLN
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60129-ANG
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60129-ACR
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60129-ANR
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60129-CF
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60129-NF
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-His tag FG60129-NH
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-HA tag FG60129-CY
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-HA tag FG60129-NY
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-Myc tag FG60129-CM
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-Myc tag FG60129-NM

eIF2A/eIF2 alpha cDNA ORF Clone, Danio rerio (zebrafish), Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone, Danio rerio (zebrafish), untagged ZG63005-UT
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63005-ACGLN

eIF2A/eIF2 alpha cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone in Cloning Vector, Human HG10112-M
eIF2A/eIF2 alpha cDNA ORF Clone, Human, untagged HG10112-UT
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10112-ACGLN
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10112-ACG
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG10112-ANG
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10112-ACR
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG10112-ANR
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10112-CF
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10112-NF
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag HG10112-CH
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-His tag HG10112-NH
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-HA tag HG10112-CY
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-HA tag HG10112-NY
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-Myc tag HG10112-CM
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-Myc tag HG10112-NM
eIF2A/eIF2 alpha qPCR Primer Pairs, Human HP100187
info info
添加购物车成功! 添加购物车失败!