EAPP cDNA ORF Clone, Ferret, untagged

Cat: FG60082-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EAPP Reagents
CRO Services
Product recommended

All EAPP Reagents
EAPP cDNA ORF Clone, Ferret, untagged General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
882 bp
Description
Full length Clone DNA of Ferret E2F-associated phosphoprotein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EAPP Background Information
Full Name
E2F-associated phosphoprotein

EAPP cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
EAPP cDNA ORF Clone in Cloning Vector, Ferret FG60082-G
EAPP Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60082-ACGLN
EAPP cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60082-ACG
EAPP cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60082-ANG
EAPP cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60082-ACR
EAPP cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60082-ANR
EAPP cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60082-CF
EAPP cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60082-NF
EAPP cDNA ORF Clone, Ferret, C-His tag FG60082-CH
EAPP cDNA ORF Clone, Ferret, N-His tag FG60082-NH
EAPP cDNA ORF Clone, Ferret, C-HA tag FG60082-CY
EAPP cDNA ORF Clone, Ferret, N-HA tag FG60082-NY
EAPP cDNA ORF Clone, Ferret, C-Myc tag FG60082-CM
EAPP cDNA ORF Clone, Ferret, N-Myc tag FG60082-NM

EAPP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EAPP cDNA ORF Clone in Cloning Vector, Rat RG80669-U
EAPP cDNA ORF Clone, Rat, untagged RG80669-UT
EAPP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80669-ACG
EAPP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80669-ACGLN
EAPP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80669-ANG
EAPP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80669-ACR
EAPP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80669-ANR
EAPP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80669-CF
EAPP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80669-NF
EAPP cDNA ORF Clone, Rat, C-His tag RG80669-CH
EAPP cDNA ORF Clone, Rat, N-His tag RG80669-NH
EAPP cDNA ORF Clone, Rat, C-HA tag RG80669-CY
EAPP cDNA ORF Clone, Rat, N-HA tag RG80669-NY
EAPP cDNA ORF Clone, Rat, C-Myc tag RG80669-CM
EAPP cDNA ORF Clone, Rat, N-Myc tag RG80669-NM
EAPP qPCR Primer Pairs, Rat RP300633

EAPP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EAPP cDNA ORF Clone in Cloning Vector, Human HG14620-G
EAPP cDNA ORF Clone, Human, untagged HG14620-UT
EAPP cDNA ORF Clone, Human, C-GFPSpark® tag HG14620-ACG
EAPP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14620-ACGLN
EAPP cDNA ORF Clone, Human, N-GFPSpark® tag HG14620-ANG
EAPP cDNA ORF Clone, Human, C-OFPSpark® tag HG14620-ACR
EAPP cDNA ORF Clone, Human, N-OFPSpark® tag HG14620-ANR
EAPP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14620-CF
EAPP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14620-NF
EAPP cDNA ORF Clone, Human, C-His tag HG14620-CH
EAPP cDNA ORF Clone, Human, N-His tag HG14620-NH
EAPP cDNA ORF Clone, Human, C-HA tag HG14620-CY
EAPP cDNA ORF Clone, Human, N-HA tag HG14620-NY
EAPP cDNA ORF Clone, Human, C-Myc tag HG14620-CM
EAPP cDNA ORF Clone, Human, N-Myc tag HG14620-NM
EAPP qPCR Primer Pairs, Human HP103254
info info
添加购物车成功! 添加购物车失败!