Cathepsin E cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60148-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin E Reagents
CRO Services
Product recommended

All Cathepsin E Reagents
Cathepsin E cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Ferret cathepsin E with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin E Background Information

Cathepsin E Protein (CTSE Protein) is a member of the peptidase C1 family that is a gastric aspartic protease that functions as a disulfide-linked homodimer. Cathepsin E Protein (CTSE Protein) is predominantly present in the cells of immune system and is frequently implicated in antigen processing via the MHC classⅡ pathway which however does not appear to be involved in the digestion of dietary protein. The protein has a specificity similar to that of pepsin and pepsin. Cathepsin E Protein (CTSE Protein) is found in highest concentration in the surface of epithelial mucus-producing cells of the stomach and also been found in more than half of the gastric cancers. It appears, therefore, to be an oncofetal antigen.

Full Name
cathepsin E
References
  • Zaidi N, et al. (2008) Emerging functional foles of cathepsin E. Biochem Biophys Res Commun. 377(2) : 327-30.
  • Zaidi N, et al. (2008) Cathepsin E: a mini review. Biochem Biophys Res Commun. 367(3) :517-22.
  • Azuma T, et al. (1989) Human gastric cathepsin E Predicted sequence, localization to chromosome 1, and sequence homology with other aspartic proteinases.The journal of biological chemistry. 264: 16748-53.
  • Cathepsin E cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Cathepsin E cDNA ORF Clone in Cloning Vector, Ferret FG60148-G
    Cathepsin E cDNA ORF Clone, Ferret, untagged FG60148-UT
    Cathepsin E cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60148-ACG
    Cathepsin E Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60148-ACGLN
    Cathepsin E cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60148-ACR
    Cathepsin E cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60148-CF
    Cathepsin E cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60148-NF
    Cathepsin E cDNA ORF Clone, Ferret, C-His tag FG60148-CH
    Cathepsin E cDNA ORF Clone, Ferret, N-His tag FG60148-NH
    Cathepsin E cDNA ORF Clone, Ferret, N-HA tag FG60148-NY
    Cathepsin E cDNA ORF Clone, Ferret, C-Myc tag FG60148-CM
    Cathepsin E cDNA ORF Clone, Ferret, N-Myc tag FG60148-NM

    Cathepsin E cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin E cDNA ORF Clone in Cloning Vector, Rat RG81240-U
    Cathepsin E cDNA ORF Clone, Rat, untagged RG81240-UT
    Cathepsin E cDNA ORF Clone, Rat, C-GFPSpark® tag RG81240-ACG
    Cathepsin E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81240-ACGLN
    Cathepsin E cDNA ORF Clone, Rat, C-OFPSpark® tag RG81240-ACR
    Cathepsin E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81240-CF
    Cathepsin E cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81240-NF
    Cathepsin E cDNA ORF Clone, Rat, C-His tag RG81240-CH
    Cathepsin E cDNA ORF Clone, Rat, N-His tag RG81240-NH
    Cathepsin E cDNA ORF Clone, Rat, C-HA tag RG81240-CY
    Cathepsin E cDNA ORF Clone, Rat, N-HA tag RG81240-NY
    Cathepsin E cDNA ORF Clone, Rat, C-Myc tag RG81240-CM
    Cathepsin E cDNA ORF Clone, Rat, N-Myc tag RG81240-NM
    Cathepsin E qPCR Primer Pairs, Rat RP301196

    Cathepsin E cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin E cDNA ORF Clone in Cloning Vector, Mouse MG50564-U
    Cathepsin E cDNA ORF Clone, Mouse, untagged MG50564-UT
    Cathepsin E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50564-ACGLN
    Cathepsin E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50564-ACG
    Cathepsin E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50564-ACR
    Cathepsin E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50564-CF
    Cathepsin E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50564-NF
    Cathepsin E cDNA ORF Clone, Mouse, C-His tag MG50564-CH
    Cathepsin E cDNA ORF Clone, Mouse, N-His tag MG50564-NH
    Cathepsin E cDNA ORF Clone, Mouse, C-HA tag MG50564-CY
    Cathepsin E cDNA ORF Clone, Mouse, N-HA tag MG50564-NY
    Cathepsin E cDNA ORF Clone, Mouse, C-Myc tag MG50564-CM
    Cathepsin E cDNA ORF Clone, Mouse, N-Myc tag MG50564-NM
    Cathepsin E qPCR Primer Pairs, Mouse MP200556

    Cathepsin E cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin E cDNA ORF Clone in Cloning Vector, Human HG10635-M
    Cathepsin E cDNA ORF Clone, Human, untagged HG10635-UT
    Cathepsin E cDNA ORF Clone, Human, C-GFPSpark® tag HG10635-ACG
    Cathepsin E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10635-ACGLN
    Cathepsin E cDNA ORF Clone, Human, C-OFPSpark® tag HG10635-ACR
    Cathepsin E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10635-CF
    Cathepsin E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10635-NF
    Cathepsin E cDNA ORF Clone, Human, C-His tag HG10635-CH
    Cathepsin E cDNA ORF Clone, Human, N-His tag HG10635-NH
    Cathepsin E cDNA ORF Clone, Human, C-HA tag HG10635-CY
    Cathepsin E cDNA ORF Clone, Human, N-HA tag HG10635-NY
    Cathepsin E cDNA ORF Clone, Human, C-Myc tag HG10635-CM
    Cathepsin E cDNA ORF Clone, Human, N-Myc tag HG10635-NM
    Cathepsin E qPCR Primer Pairs, Human HP100610
    info info
    添加购物车成功! 添加购物车失败!