CNOT2 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60105-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CNOT2 Reagents
CRO Services
Product recommended

All CNOT2 Reagents
CNOT2 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1623 bp
Description
Full length Clone DNA of Ferret CCR4-NOT transcription complex, subunit 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNOT2 Background Information
Full Name
CCR4-NOT transcription complex, subunit 2

CNOT2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CNOT2 cDNA ORF Clone in Cloning Vector, Ferret FG60105-G
CNOT2 cDNA ORF Clone, Ferret, untagged FG60105-UT
CNOT2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60105-ACGLN
CNOT2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60105-ACG
CNOT2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60105-ANG
CNOT2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60105-ACR
CNOT2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60105-ANR
CNOT2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60105-CF
CNOT2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60105-NF
CNOT2 cDNA ORF Clone, Ferret, C-His tag FG60105-CH
CNOT2 cDNA ORF Clone, Ferret, N-His tag FG60105-NH
CNOT2 cDNA ORF Clone, Ferret, C-HA tag FG60105-CY
CNOT2 cDNA ORF Clone, Ferret, C-Myc tag FG60105-CM
CNOT2 cDNA ORF Clone, Ferret, N-Myc tag FG60105-NM

CNOT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNOT2 cDNA ORF Clone in Cloning Vector, Mouse MG51804-U
CNOT2 cDNA ORF Clone, Mouse, untagged MG51804-UT
CNOT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51804-ACG
CNOT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51804-ACGLN
CNOT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51804-ANG
CNOT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51804-ACR
CNOT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51804-ANR
CNOT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51804-CF
CNOT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51804-NF
CNOT2 cDNA ORF Clone, Mouse, C-His tag MG51804-CH
CNOT2 cDNA ORF Clone, Mouse, N-His tag MG51804-NH
CNOT2 cDNA ORF Clone, Mouse, C-HA tag MG51804-CY
CNOT2 cDNA ORF Clone, Mouse, N-HA tag MG51804-NY
CNOT2 cDNA ORF Clone, Mouse, C-Myc tag MG51804-CM
CNOT2 cDNA ORF Clone, Mouse, N-Myc tag MG51804-NM
CNOT2 qPCR Primer Pairs, Mouse MP201677

CNOT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNOT2 cDNA ORF Clone in Cloning Vector, Human HG16817-U
CNOT2 cDNA ORF Clone in Cloning Vector, Human HG29644-U
CNOT2 cDNA ORF Clone, Human, untagged HG16817-UT
CNOT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16817-ACGLN
CNOT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29644-ACGLN
CNOT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16817-ACG
CNOT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16817-ANG
CNOT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16817-ACR
CNOT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16817-ANR
CNOT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16817-CF
CNOT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16817-NF
CNOT2 cDNA ORF Clone, Human, C-His tag HG16817-CH
CNOT2 cDNA ORF Clone, Human, N-His tag HG16817-NH
CNOT2 cDNA ORF Clone, Human, C-HA tag HG16817-CY
CNOT2 cDNA ORF Clone, Human, N-HA tag HG16817-NY
CNOT2 cDNA ORF Clone, Human, C-Myc tag HG16817-CM
CNOT2 cDNA ORF Clone, Human, N-Myc tag HG16817-NM
info info
添加购物车成功! 添加购物车失败!