CD4 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60003-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD4 Reagents
CRO Services
Product recommended

All CD4 Reagents
CD4 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1389 bp
Description
Full length Clone DNA of Ferret CD4 antigen with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD4 Background Information

T-cell surface glycoprotein CD4,  is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.

Full Name
CD4 molecule
References
  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.
  • CD4 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    CD4 cDNA ORF Clone in Cloning Vector, Ferret FG60003-G
    CD4 cDNA ORF Clone, Ferret, untagged FG60003-UT
    CD4 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60003-ACGLN
    CD4 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60003-ACG
    CD4 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60003-ACR
    CD4 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60003-CF
    CD4 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60003-NF
    CD4 cDNA ORF Clone, Ferret, N-His tag FG60003-NH
    CD4 cDNA ORF Clone, Ferret, C-HA tag FG60003-CY
    CD4 cDNA ORF Clone, Ferret, N-HA tag FG60003-NY
    CD4 cDNA ORF Clone, Ferret, C-Myc tag FG60003-CM
    CD4 cDNA ORF Clone, Ferret, N-Myc tag FG60003-NM

    CD4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD4 cDNA ORF Clone in Cloning Vector, Rhesus CG90274-G
    CD4 cDNA ORF Clone, Rhesus, untagged CG90274-UT
    CD4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90274-ACGLN
    CD4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90274-ACG
    CD4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90274-ACR
    CD4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90274-CF
    CD4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90274-NF
    CD4 cDNA ORF Clone, Rhesus, C-His tag CG90274-CH
    CD4 cDNA ORF Clone, Rhesus, N-His tag CG90274-NH
    CD4 cDNA ORF Clone, Rhesus, C-HA tag CG90274-CY
    CD4 cDNA ORF Clone, Rhesus, N-HA tag CG90274-NY
    CD4 cDNA ORF Clone, Rhesus, C-Myc tag CG90274-CM
    CD4 cDNA ORF Clone, Rhesus, N-Myc tag CG90274-NM

    CD4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD4 cDNA ORF Clone in Cloning Vector, Rat RG80086-G
    CD4 cDNA ORF Clone, Rat, untagged RG80086-UT
    CD4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80086-ACGLN
    CD4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80086-ACG
    CD4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80086-ACR
    CD4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80086-CF
    CD4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80086-NF
    CD4 cDNA ORF Clone, Rat, C-His tag RG80086-CH
    CD4 cDNA ORF Clone, Rat, N-His tag RG80086-NH
    CD4 cDNA ORF Clone, Rat, C-HA tag RG80086-CY
    CD4 cDNA ORF Clone, Rat, N-HA tag RG80086-NY
    CD4 cDNA ORF Clone, Rat, C-Myc tag RG80086-CM
    CD4 cDNA ORF Clone, Rat, N-Myc tag RG80086-NM
    CD4 qPCR Primer Pairs, Rat RP300082

    CD4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD4 cDNA ORF Clone in Cloning Vector, Mouse MG50134-M
    CD4 cDNA ORF Clone, Mouse, untagged MG50134-UT
    CD4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50134-ACG
    CD4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50134-ACGLN
    CD4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50134-ACR
    CD4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50134-CF
    CD4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50134-NF
    CD4 cDNA ORF Clone, Mouse, C-His tag MG50134-CH
    CD4 cDNA ORF Clone, Mouse, N-His tag MG50134-NH
    CD4 cDNA ORF Clone, Mouse, C-HA tag MG50134-CY
    CD4 cDNA ORF Clone, Mouse, N-HA tag MG50134-NY
    CD4 cDNA ORF Clone, Mouse, C-Myc tag MG50134-CM
    CD4 cDNA ORF Clone, Mouse, N-Myc tag MG50134-NM
    CD4 qPCR Primer Pairs, Mouse MP200164

    CD4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD4 cDNA ORF Clone in Cloning Vector, Human HG10400-M
    CD4 cDNA ORF Clone, Human, untagged HG10400-UT
    CD4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10400-ACG
    CD4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10400-ACGLN
    CD4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10400-ACR
    CD4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10400-CF
    CD4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10400-NF
    CD4 cDNA ORF Clone, Human, C-His tag HG10400-CH
    CD4 cDNA ORF Clone, Human, N-His tag HG10400-NH
    CD4 cDNA ORF Clone, Human, C-HA tag HG10400-CY
    CD4 cDNA ORF Clone, Human, N-HA tag HG10400-NY
    CD4 cDNA ORF Clone, Human, C-Myc tag HG10400-CM
    CD4 cDNA ORF Clone, Human, N-Myc tag HG10400-NM
    CD4 qPCR Primer Pairs, Human HP100431
    info info
    添加购物车成功! 添加购物车失败!