Quick Order

Ferret CD20/MS4A1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Ferret MS4A1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Ferret membrane-spanning 4-domains, subfamily A, member 1 with C terminal His tag.
Gene Synonym:MS4A1
Species:Ferret
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

References
  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • Size / Price
    Catalog: FG60004-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"