BUB3 cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60153-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BUB3 Reagents
CRO Services
Product recommended

All BUB3 Reagents
BUB3 cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Ferret BUB3 mitotic checkpoint protein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BUB3 Background Information
Full Name
BUB3 mitotic checkpoint protein

BUB3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
BUB3 cDNA ORF Clone in Cloning Vector, Ferret FG60153-G
BUB3 cDNA ORF Clone, Ferret, untagged FG60153-UT
BUB3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60153-ACGLN
BUB3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60153-ACG
BUB3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60153-ANG
BUB3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60153-ACR
BUB3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60153-ANR
BUB3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60153-CF
BUB3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60153-NF
BUB3 cDNA ORF Clone, Ferret, C-His tag FG60153-CH
BUB3 cDNA ORF Clone, Ferret, N-His tag FG60153-NH
BUB3 cDNA ORF Clone, Ferret, N-HA tag FG60153-NY
BUB3 cDNA ORF Clone, Ferret, C-Myc tag FG60153-CM
BUB3 cDNA ORF Clone, Ferret, N-Myc tag FG60153-NM

BUB3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BUB3 cDNA ORF Clone in Cloning Vector, Human HG11236-M
BUB3 cDNA ORF Clone, Human, untagged HG11236-UT
BUB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11236-ACGLN
BUB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11236-ACG
BUB3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11236-ANG
BUB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11236-ACR
BUB3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11236-ANR
BUB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11236-CF
BUB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11236-NF
BUB3 cDNA ORF Clone, Human, C-His tag HG11236-CH
BUB3 cDNA ORF Clone, Human, N-His tag HG11236-NH
BUB3 cDNA ORF Clone, Human, C-HA tag HG11236-CY
BUB3 cDNA ORF Clone, Human, N-HA tag HG11236-NY
BUB3 cDNA ORF Clone, Human, C-Myc tag HG11236-CM
BUB3 cDNA ORF Clone, Human, N-Myc tag HG11236-NM
BUB3 qPCR Primer Pairs, Human HP101180
info info
添加购物车成功! 添加购物车失败!