ARF1 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60118-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARF1 Reagents
CRO Services
Product recommended

All ARF1 Reagents
ARF1 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Ferret ADP-ribosylation factor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARF1 Background Information
Full Name
ADP ribosylation factor 1

ARF1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ARF1 cDNA ORF Clone in Cloning Vector, Ferret FG60118-G
ARF1 cDNA ORF Clone, Ferret, untagged FG60118-UT
ARF1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60118-ACGLN
ARF1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60118-ACG
ARF1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60118-ANG
ARF1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60118-ACR
ARF1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60118-ANR
ARF1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60118-CF
ARF1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60118-NF
ARF1 cDNA ORF Clone, Ferret, C-His tag FG60118-CH
ARF1 cDNA ORF Clone, Ferret, N-His tag FG60118-NH
ARF1 cDNA ORF Clone, Ferret, C-HA tag FG60118-CY
ARF1 cDNA ORF Clone, Ferret, C-Myc tag FG60118-CM
ARF1 cDNA ORF Clone, Ferret, N-Myc tag FG60118-NM

ARF1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ARF1 cDNA ORF Clone in Cloning Vector, Rhesus CG90571-G
ARF1 cDNA ORF Clone, Rhesus, untagged CG90571-UT
ARF1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90571-ACGLN
ARF1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90571-ACG
ARF1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90571-ANG
ARF1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90571-ACR
ARF1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90571-ANR
ARF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90571-CF
ARF1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90571-NF
ARF1 cDNA ORF Clone, Rhesus, C-His tag CG90571-CH
ARF1 cDNA ORF Clone, Rhesus, N-His tag CG90571-NH
ARF1 cDNA ORF Clone, Rhesus, C-HA tag CG90571-CY
ARF1 cDNA ORF Clone, Rhesus, N-HA tag CG90571-NY
ARF1 cDNA ORF Clone, Rhesus, C-Myc tag CG90571-CM
ARF1 cDNA ORF Clone, Rhesus, N-Myc tag CG90571-NM

ARF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARF1 cDNA ORF Clone in Cloning Vector, Rat RG80952-U
ARF1 cDNA ORF Clone, Rat, untagged RG80952-UT
ARF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80952-ACGLN
ARF1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80952-ACG
ARF1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80952-ACR
ARF1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80952-CF
ARF1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80952-NF
ARF1 cDNA ORF Clone, Rat, C-His tag RG80952-CH
ARF1 cDNA ORF Clone, Rat, N-His tag RG80952-NH
ARF1 cDNA ORF Clone, Rat, C-HA tag RG80952-CY
ARF1 cDNA ORF Clone, Rat, N-HA tag RG80952-NY
ARF1 cDNA ORF Clone, Rat, C-Myc tag RG80952-CM
ARF1 cDNA ORF Clone, Rat, N-Myc tag RG80952-NM
ARF1 qPCR Primer Pairs, Rat RP300916

ARF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARF1 cDNA ORF Clone in Cloning Vector, Mouse MG52116-G
ARF1 cDNA ORF Clone, Mouse, untagged MG52116-UT
ARF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52116-ACG
ARF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52116-ACGLN
ARF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52116-ANG
ARF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52116-ACR
ARF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52116-ANR
ARF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52116-CF
ARF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52116-NF
ARF1 cDNA ORF Clone, Mouse, C-His tag MG52116-CH
ARF1 cDNA ORF Clone, Mouse, N-His tag MG52116-NH
ARF1 cDNA ORF Clone, Mouse, C-HA tag MG52116-CY
ARF1 cDNA ORF Clone, Mouse, N-HA tag MG52116-NY
ARF1 cDNA ORF Clone, Mouse, C-Myc tag MG52116-CM
ARF1 cDNA ORF Clone, Mouse, N-Myc tag MG52116-NM
ARF1 qPCR Primer Pairs, Mouse MP201989

ARF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARF1 cDNA ORF Clone in Cloning Vector, Human HG14968-G
ARF1 cDNA ORF Clone, Human, untagged HG14968-UT
ARF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14968-ACG
ARF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14968-ACGLN
ARF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14968-ACR
ARF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14968-CF
ARF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14968-NF
ARF1 cDNA ORF Clone, Human, C-His tag HG14968-CH
ARF1 cDNA ORF Clone, Human, N-His tag HG14968-NH
ARF1 cDNA ORF Clone, Human, C-HA tag HG14968-CY
ARF1 cDNA ORF Clone, Human, N-HA tag HG14968-NY
ARF1 cDNA ORF Clone, Human, C-Myc tag HG14968-CM
ARF1 cDNA ORF Clone, Human, N-Myc tag HG14968-NM
ARF1 qPCR Primer Pairs, Human HP103597
info info
添加购物车成功! 添加购物车失败!