AP1M1 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60146-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AP1M1 Reagents
CRO Services
Product recommended

All AP1M1 Reagents
AP1M1 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Ferret adaptor-related protein complex 1, mu 1 subunit with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AP1M1 Background Information
Full Name
adaptor related protein complex 1 mu 1 subunit

AP1M1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
AP1M1 cDNA ORF Clone in Cloning Vector, Ferret FG60146-G
AP1M1 cDNA ORF Clone, Ferret, untagged FG60146-UT
AP1M1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60146-ACGLN
AP1M1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60146-ACG
AP1M1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60146-ANG
AP1M1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60146-ACR
AP1M1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60146-ANR
AP1M1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60146-CF
AP1M1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60146-NF
AP1M1 cDNA ORF Clone, Ferret, C-His tag FG60146-CH
AP1M1 cDNA ORF Clone, Ferret, N-His tag FG60146-NH
AP1M1 cDNA ORF Clone, Ferret, C-HA tag FG60146-CY
AP1M1 cDNA ORF Clone, Ferret, C-Myc tag FG60146-CM
AP1M1 cDNA ORF Clone, Ferret, N-Myc tag FG60146-NM

AP1M1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
AP1M1 cDNA ORF Clone in Cloning Vector, Mouse MG52924-U
AP1M1 cDNA ORF Clone, Mouse, untagged MG52924-UT
AP1M1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52924-ACG
AP1M1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52924-ACGLN
AP1M1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52924-ANG
AP1M1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52924-ACR
AP1M1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52924-ANR
AP1M1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52924-CF
AP1M1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52924-NF
AP1M1 cDNA ORF Clone, Mouse, C-His tag MG52924-CH
AP1M1 cDNA ORF Clone, Mouse, N-His tag MG52924-NH
AP1M1 cDNA ORF Clone, Mouse, C-HA tag MG52924-CY
AP1M1 cDNA ORF Clone, Mouse, N-HA tag MG52924-NY
AP1M1 cDNA ORF Clone, Mouse, C-Myc tag MG52924-CM
AP1M1 cDNA ORF Clone, Mouse, N-Myc tag MG52924-NM

AP1M1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AP1M1 cDNA ORF Clone in Cloning Vector, Human HG13004-U
AP1M1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13004-ACGLN
info info
添加购物车成功! 添加购物车失败!