AICDA cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60152-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All AICDA Reagents
CRO Services
Product recommended

All AICDA Reagents
AICDA cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
633 bp
Description
Full length Clone DNA of Ferret activation-induced cytidine deaminase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AICDA Background Information
Full Name
activation-induced cytidine deaminase

AICDA cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
AICDA cDNA ORF Clone in Cloning Vector, Ferret FG60152-G
AICDA cDNA ORF Clone, Ferret, untagged FG60152-UT
AICDA Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60152-ACGLN
AICDA cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60152-ACG
AICDA cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60152-ANG
AICDA cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60152-ACR
AICDA cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60152-ANR
AICDA cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60152-CF
AICDA cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60152-NF
AICDA cDNA ORF Clone, Ferret, C-His tag FG60152-CH
AICDA cDNA ORF Clone, Ferret, N-His tag FG60152-NH
AICDA cDNA ORF Clone, Ferret, N-HA tag FG60152-NY
AICDA cDNA ORF Clone, Ferret, C-Myc tag FG60152-CM
AICDA cDNA ORF Clone, Ferret, N-Myc tag FG60152-NM

AICDA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
AICDA cDNA ORF Clone in Cloning Vector, Human HG15667-G
AICDA cDNA ORF Clone, Human, untagged HG15667-UT
AICDA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15667-ACGLN
AICDA cDNA ORF Clone, Human, C-GFPSpark® tag HG15667-ACG
AICDA cDNA ORF Clone, Human, N-GFPSpark® tag HG15667-ANG
AICDA cDNA ORF Clone, Human, C-OFPSpark® tag HG15667-ACR
AICDA cDNA ORF Clone, Human, N-OFPSpark® tag HG15667-ANR
AICDA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15667-CF
AICDA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15667-NF
AICDA cDNA ORF Clone, Human, C-His tag HG15667-CH
AICDA cDNA ORF Clone, Human, N-His tag HG15667-NH
AICDA cDNA ORF Clone, Human, C-HA tag HG15667-CY
AICDA cDNA ORF Clone, Human, N-HA tag HG15667-NY
AICDA cDNA ORF Clone, Human, C-Myc tag HG15667-CM
AICDA cDNA ORF Clone, Human, N-Myc tag HG15667-NM
AICDA qPCR Primer Pairs, Human HP104282
info info
添加购物车成功! 添加购物车失败!