ABHD16A cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60097-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ABHD16A Reagents
CRO Services
Product recommended

All ABHD16A Reagents
ABHD16A cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1677 bp
Description
Full length Clone DNA of Ferret abhydrolase domain containing 16A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD16A Background Information
Full Name
abhydrolase domain containing 16A

ABHD16A cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
ABHD16A cDNA ORF Clone in Cloning Vector, Ferret FG60097-G
ABHD16A cDNA ORF Clone, Ferret, untagged FG60097-UT
ABHD16A cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60097-ACG
ABHD16A Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60097-ACGLN
ABHD16A cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60097-ANG
ABHD16A cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60097-ACR
ABHD16A cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60097-ANR
ABHD16A cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60097-CF
ABHD16A cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60097-NF
ABHD16A cDNA ORF Clone, Ferret, C-His tag FG60097-CH
ABHD16A cDNA ORF Clone, Ferret, N-His tag FG60097-NH
ABHD16A cDNA ORF Clone, Ferret, N-HA tag FG60097-NY
ABHD16A cDNA ORF Clone, Ferret, C-Myc tag FG60097-CM
ABHD16A cDNA ORF Clone, Ferret, N-Myc tag FG60097-NM

ABHD16A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ABHD16A cDNA ORF Clone in Cloning Vector, Rat RG81452-G

ABHD16A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ABHD16A cDNA ORF Clone in Cloning Vector, Mouse MG51864-G
ABHD16A cDNA ORF Clone, Mouse, untagged MG51864-UT
ABHD16A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51864-ACGLN
ABHD16A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51864-ACG
ABHD16A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51864-ANG
ABHD16A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51864-ACR
ABHD16A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51864-ANR
ABHD16A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51864-CF
ABHD16A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51864-NF
ABHD16A cDNA ORF Clone, Mouse, C-His tag MG51864-CH
ABHD16A cDNA ORF Clone, Mouse, N-His tag MG51864-NH
ABHD16A cDNA ORF Clone, Mouse, C-HA tag MG51864-CY
ABHD16A cDNA ORF Clone, Mouse, N-HA tag MG51864-NY
ABHD16A cDNA ORF Clone, Mouse, C-Myc tag MG51864-CM
ABHD16A cDNA ORF Clone, Mouse, N-Myc tag MG51864-NM
ABHD16A qPCR Primer Pairs, Mouse MP201737
info info
添加购物车成功! 添加购物车失败!