_×
Human FOXP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human FOXP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Human FOXP2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG12029-G-F
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

FOXP2 cDNA Clone Datasheet

 

FOXP2 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_021804.1

cDNA Size:

2148

Gene Synonym:

CAGH44

Source: Human

FOXP2 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens forkhead box P2 DNA.

Vector:

pCMV/hygro-FLAG

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

FOXP2 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

FOXP2 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

FOXP2 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGATGCAGG AATCTGCGAC AGAGACAATA AGCAACAGTT CAATGAATCA AAATGGAATG
61       AGCACTCTAA GCAGCCAATT AGATGCTGGC AGCAGAGATG GAAGATCAAG TGGTGACACC
121      AGCTCTGAAG TAAGCACAGT AGAACTGCTG CATCTGCAAC AACAGCAGGC TCTCCAGGCA
181      GCAAGACAAC TTCTTTTACA GCAGCAAACA AGTGGATTGA AATCTCCTAA GAGCAGTGAT
241      AAACAGAGAC CACTGCAGGT GCCTGTGTCA GTGGCCATGA TGACTCCCCA GGTGATCACC
301      CCTCAGCAAA TGCAGCAGAT CCTTCAGCAA CAAGTCCTGT CTCCTCAGCA GCTACAAGCC
361      CTTCTCCAAC AACAGCAGGC TGTCATGCTG CAGCAGCAAC AACTACAAGA GTTTTACAAG
421      AAACAGCAAG AGCAGTTACA TCTTCAGCTT TTGCAGCAGC AGCAGCAACA GCAGCAGCAG
481      CAACAACAGC AGCAACAACA GCAGCAGCAA CAACAACAAC AACAGCAGCA ACAACAGCAG
541      CAGCAGCAGC AACAGCAGCA GCAGCAGCAA CAGCATCCTG GAAAGCAAGC GAAAGAGCAG
601      CAGCAGCAGC AGCAGCAGCA ACAGCAATTG GCAGCCCAGC AGCTTGTCTT CCAGCAGCAG
661      CTTCTCCAGA TGCAACAACT CCAGCAGCAG CAGCATCTGC TCAGCCTTCA GCGTCAGGGA
721      CTCATCTCCA TTCCACCTGG CCAGGCAGCA CTTCCTGTCC AATCGCTGCC TCAAGCTGGC
781      TTAAGTCCTG CTGAGATTCA GCAGTTATGG AAAGAAGTGA CTGGAGTTCA CAGTATGGAA
841      GACAATGGCA TTAAACATGG AGGGCTAGAC CTCACTACTA ACAATTCCTC CTCGACTACC
901      TCCTCCAACA CTTCCAAAGC ATCACCACCA ATAACTCATC ATTCCATAGT GAATGGACAG
961      TCTTCAGTTC TAAGTGCAAG ACGAGACAGC TCGTCACATG AGGAGACTGG GGCCTCTCAC
1021     ACTCTCTATG GCCATGGAGT TTGCAAATGG CCAGGCTGTG AAAGCATTTG TGAAGATTTT
1081     GGACAGTTTT TAAAGCACCT TAACAATGAA CACGCATTGG ATGACCGAAG CACTGCTCAG
1141     TGTCGAGTGC AAATGCAGGT GGTGCAACAG TTAGAAATAC AGCTTTCTAA AGAACGCGAA
1201     CGTCTTCAAG CAATGATGAC CCACTTGCAC ATGCGACCCT CAGAGCCCAA ACCATCTCCC
1261     AAACCTCTAA ATCTGGTGTC TAGTGTCACC ATGTCGAAGA ATATGTTGGA GACATCCCCA
1321     CAGAGCTTAC CTCAAACCCC TACCACACCA ACGGCCCCAG TCACCCCGAT TACCCAGGGA
1381     CCCTCAGTAA TCACCCCAGC CAGTGTGCCC AATGTGGGAG CCATACGAAG GCGACATTCA
1441     GACAAATACA ACATTCCCAT GTCATCAGAA ATTGCCCCAA ACTATGAATT TTATAAAAAT
1501     GCAGATGTCA GACCTCCATT TACTTATGCA ACTCTCATAA GGCAGGCTAT CATGGAGTCA
1561     TCTGACAGGC AGTTAACACT TAATGAAATT TACAGCTGGT TTACACGGAC ATTTGCTTAC
1621     TTCAGGCGTA ATGCAGCAAC TTGGAAGAAT GCAGTACGTC ATAATCTTAG CCTGCACAAG
1681     TGTTTTGTTC GAGTAGAAAA TGTTAAAGGA GCAGTATGGA CTGTGGATGA AGTAGAATAC
1741     CAGAAGCGAA GGTCACAAAA GATAACAGGA AGTCCAACCT TAGTAAAAAA TATACCTACC
1801     AGTTTAGGCT ATGGAGCAGC TCTTAATGCC AGTTTGCAGG CTGCCTTGGC AGAGAGCAGT
1861     TTACCTTTGC TAAGTAATCC TGGACTGATA AATAATGCAT CCAGTGGCCT ACTGCAGGCC
1921     GTCCACGAAG ACCTCAATGG TTCTCTGGAT CACATTGACA GCAATGGAAA CAGTAGTCCG
1981     GGCTGCTCAC CTCAGCCGCA CATACATTCA ATCCACGTCA AGGAAGAGCC AGTGATTGCA
2041     GAGGATGAAG ACTGCCCAAT GTCCTTAGTG ACAACAGCTA ATCACAGTCC AGAATTAGAA
2101     GACGACAGAG AGATTGAAGA AGAGCCTTTA TCTGAAGATC TGGAAGCT1GA TTACAAGGAT
2161     GACGACGATA AG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. FLAG Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"