Quick Order

Text Size:AAA

Human FOS / c-Fos Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FOS cDNA Clone Product Information
NCBI RefSeq:NM_005252.2
RefSeq ORF Size:1143bp
cDNA Description:Full length Clone DNA of Homo sapiens v-fos FBJ murine osteosarcoma viral oncogene homolog.
Gene Synonym:FOS, AP-1, C-FOS
Restriction Site:HindIII + XbaI (5.5kb + 1.14kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FOS Gene Plasmid Map
Human FOS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10075-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human FOS Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.