Quick Order

DatasheetReviewsRelated ProductsProtocols
Mouse FOLR1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Mouse FOLR1 Gene Plasmid Map
Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene.
Folate receptor α (FRα) is the most important subunit of Folate receptor and the alpha isoform has been shown to be selectively overexpressed in cancer types like breast and ovarian cancer compared to normal breast and ovarian epithelial cells. It was determined that Folate receptor α exhibits a limited expression on the apical surfaces of the epithelial cells of normal lung, breast, thyroid, parathyroid, and kidney tissues. For their uptake of folate, normal cells rely almost exclusively on the reduced folate carrier, whereas many carcinomas and myeloid leukemia cells overexpress a high-affinity FR on their surfaces, perhaps reflecting their increased need for folate to support rapid cell division

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Senol S, Ceyran AB, Aydin A, et al. Folate receptor α expression and significance in endometrioid endometrium carcinoma and endometrial hyperplasia. International Journal of Clinical and Experimental Pathology. 2015;8(5):5633-5641.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"