Quick Order

Text Size:AAA

Mouse FLT3 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse FLT3 cDNA Clone Product Information
NCBI RefSeq:NM_010229.2
RefSeq ORF Size:3003bp
cDNA Description:Full length Clone DNA of Mus musculus FMS-like tyrosine kinase 3.
Gene Synonym:Flk2, Ly72, wmfl, CD135, Flk-2, Flt-3, B230315G04
Restriction Site:KpnI + XhoI (5.5kb + 3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 501 C/T, 510 A/G, 573 A/G, 543 C/T, 2580 T/C and 2946 A/G not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FLT3 Gene Plasmid Map
Mouse FLT3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.