Text Size:AAA

Rat FGFR4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGFR4cDNA Clone Product Information
Gene Bank Ref.ID:NM_001109904.1
cDNA Size:2418
cDNA Description:ORF Clone of Rattus norvegicus fibroblast growth factor receptor 4 DNA.
Gene Synonym:MGC116290, Fgfr4
Species:Rat
Vector:pCMV/hygro
Restriction Site:HindIII + EcoRI
Tag Sequence:
Sequence Description:Same as Gene Bank Ref. ID sequence with the nucleotide (2255-2269) insertion mutation and the point mutation 567 A/G not causing the amino acid variation.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Rat FGFR4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

pCMV/hygro vector information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Human FGF7 / FGF-7 / KGF Protein (His Tag)Human FGFBP3 Protein (His Tag)Canine FGF12 ProteinHuman FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinCynomolgus FGFR3 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human / Cynomolgus FGF16 / FGF-16 ProteinMouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Canine aFGF / FGF1 ProteinHuman FGF9 Protein (Fc Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Mouse bFGF / FGF2 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Canine FGF9 / FGF-9 Protein (Fc Tag)Canine FGF14 / SCA27 ProteinHuman FGF21 Protein (His Tag)Human FGF19 ProteinHuman FGF17 Protein
Background

Fibroblast growth factor receptor 4 (FGFR4) also known as CD334 antigen or tyrosine kinase related to fibroblast growth factor receptor, is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR4/CD334 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. FGFR4/CD334 preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. FGFR4/CD334 signaling is down-regulated by receptor internalization and degradation; MMP14 promotes internalization and degradation of FGFR4/CD334. Mutations in FGFR4/CD334 lead to constitutive kinase activation or impair normal FGFR4 inactivation lead to aberrant signaling.

References
  • Hart KC, et al. (2000) Transformation and Stat activation by derivatives of FGFR1, FGFR3, and FGFR4. Oncogene. 19(29): 3309-20.
  • Xie MH, et al. (1999) FGF-19, a novel fibroblast growth factor with unique specificity for FGFR4. Cytokine. 11(10): 729-35.
  • Yu C, et al. (2000) Elevated cholesterol metabolism and bile acid synthesis in mice lacking membrane tyrosine kinase receptor FGFR4. J Biol Chem. 275(20): 15482-9.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"