Text Size:AAA

Human FGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FGFR2cDNA Clone Product Information
Gene Bank Ref.ID:NM_000141.4
cDNA Size:2466
cDNA Description:ORF Clone of Homo sapiens fibroblast growth factor receptor 2 DNA.
Gene Synonym:BEK, JWS, CEK3, CFD1, ECT1, KGFR, TK14, TK25, BFR-1, CD332, K-SAM, FLJ98662, FGFR2
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 159 G/A and 696 A/G not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Fibroblast Growth Factor (FGF) & Receptor Related Products
Product nameProduct name
Human FGF7 / FGF-7 / KGF Protein (His Tag)Canine aFGF / FGF1 ProteinMouse bFGF / FGF2 Protein (His Tag)Human aFGF / FGF1 ProteinHuman bFGF / FGF2 ProteinHuman FGFBP3 Protein (His Tag)Human FGF9 Protein (Fc Tag)Canine FGF12 ProteinHuman FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF17 ProteinMouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His Tag)Rat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Human FGF10 ProteinHuman / Cynomolgus FGF16 / FGF-16 ProteinCynomolgus FGFR3 Protein (Fc Tag)Human FGFR1 / CD331 Protein (His Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Mouse FGF18 / FGF-18 Protein (His Tag)Mouse / Rat aFGF / FGF1 ProteinMouse FGFRL1 / FGFR5 Protein (His Tag)Human FGF18 / FGF-18 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Cynomolgus aFGF / FGF1 ProteinCynomolgus FGFR1 / CD331 Protein (Fc Tag)Cynomolgus FGFR1 / CD331 Protein (His Tag)Human FGFR1OP / FOP Protein (His & GST Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Cynomolgus FGFR4 / FGF Receptor 4 Protein (His Tag)Cynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGF14 / SCA27 Protein (isoform 1B)Mouse FGF7 / FGF-7 / KGF Protein (His Tag)Canine FGF9 / FGF-9 Protein (Fc Tag)Human FGFR2 Protein (His & Fc Tag)Human FGFR2 / CD332 Protein (His Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Mouse FGF21 / Fibroblast Growth Factor 21 Protein (His Tag)Canine FGF14 / SCA27 ProteinHuman FGF21 Protein (His Tag)Human FGF19 Protein

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.

  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.
  • Catalog:HG10824-M-N
    List Price: $545.00  (Save $230.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human FGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged