Quick Order

DatasheetReviewsRelated ProductsProtocols
Human FGFR2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human FGFR2 Gene Plasmid Map
Human FGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

FGFR2, also known as CD332, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR2 acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. It is required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. FGFR2 plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. It also promotes cell proliferation in keratinocytes and imature osteoblasts, but promotes apoptosis in differentiated osteoblasts. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal CD332 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. Defects in CD3322 are the cause of Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, Beare-Stevenson cutis gyrata syndrome, familial scaphocephaly syndrome, lacrimo-auriculo-dento-digital syndrome and Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Marie PJ, et al. (2003) Regulation of human cranial osteoblast phenotype by FGF-2, FGFR-2 and BMP-2 signaling. Histol. 17(3):877-85.
  • Park WJ, et al. (1996) Novel FGFR2 mutations in Crouzon and Jackson-Weiss syndromes show allelic heterogeneity and phenotypic variability. Hum Mol Genet. 4(7):1229-33.
  • Orr-Urtreger A, et al. (1993) Developmental localization of the splicing alternatives of fibroblast growth factor receptor-2 (FGFR2). Dev Biol. 158(2):475-86.
  • Contact Us
    • Human FGFR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.