After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse FGFR1/CD331 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse FGFR1 cDNA Clone Product Information
NCBI RefSeq:NM_010206.2
RefSeq ORF Size:2469bp
cDNA Description:Full length Clone DNA of Mus musculus fibroblast growth factor receptor 1, transcript variant 1 with Flag tag.
Gene Synonym:FLG, Flt-2, Fgfr-1, AW208770, Fgfr1
Restriction Site:KpnI + XbaI (5.5kb + 2.5kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 84 T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FGFR1 Gene Plasmid Map
Mouse FGFR1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome ,idiopathic hypogonadotropic hypogonadism, Kallmann syndrome type 2, osteoglophonic dysplasia and trigonocephaly non-syndromic.

  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.
  • Contact Us
    • Mouse FGFR1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.