FGFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50186-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FGFR1 Reagents
CRO Services

All FGFR1 Reagents
FGFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2469 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 84 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse fibroblast growth factor receptor 1, transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XbaI (5.5kb + 2.5kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGFR1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Human Vimentin Gene Plasmid Map 7163
FGFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AW208770 cDNA ORF Clone, Mouse;bFGF-R-1 cDNA ORF Clone, Mouse;c-fgr cDNA ORF Clone, Mouse;Eask cDNA ORF Clone, Mouse;Fgfr-1 cDNA ORF Clone, Mouse;FLG cDNA ORF Clone, Mouse;Flt-2 cDNA ORF Clone, Mouse;Hspy cDNA ORF Clone, Mouse;MFR cDNA ORF Clone, Mouse
FGFR1 Background Information

FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome ,idiopathic hypogonadotropic hypogonadism, Kallmann syndrome type 2, osteoglophonic dysplasia and trigonocephaly non-syndromic.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fibroblast growth factor receptor 1
References
  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.
  • FGFR1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    FGFR1 cDNA ORF Clone in Cloning Vector, Rhesus CG90075-G
    FGFR1 cDNA ORF Clone, Rhesus, untagged CG90075-UT
    FGFR1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90075-ACG
    FGFR1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90075-ACGLN
    FGFR1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90075-ACR
    FGFR1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90075-CF
    FGFR1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90075-NF
    FGFR1 cDNA ORF Clone, Rhesus, C-His tag CG90075-CH
    FGFR1 cDNA ORF Clone, Rhesus, N-His tag CG90075-NH
    FGFR1 cDNA ORF Clone, Rhesus, C-HA tag CG90075-CY
    FGFR1 cDNA ORF Clone, Rhesus, N-HA tag CG90075-NY
    FGFR1 cDNA ORF Clone, Rhesus, C-Myc tag CG90075-CM
    FGFR1 cDNA ORF Clone, Rhesus, N-Myc tag CG90075-NM

    FGFR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGFR1 cDNA ORF Clone in Cloning Vector, Mouse MG50186-M
    FGFR1 cDNA ORF Clone, Mouse, untagged MG50186-UT
    FGFR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50186-ACG
    FGFR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50186-ACGLN
    FGFR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50186-ACR
    FGFR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50186-CF
    FGFR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50186-NF
    FGFR1 cDNA ORF Clone, Mouse, C-His tag MG50186-CH
    FGFR1 cDNA ORF Clone, Mouse, N-His tag MG50186-NH
    FGFR1 cDNA ORF Clone, Mouse, C-HA tag MG50186-CY
    FGFR1 cDNA ORF Clone, Mouse, N-HA tag MG50186-NY
    FGFR1 cDNA ORF Clone, Mouse, C-Myc tag MG50186-CM
    FGFR1 cDNA ORF Clone, Mouse, N-Myc tag MG50186-NM
    FGFR1 qPCR Primer Pairs, Mouse MP200216

    FGFR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGFR1 cDNA ORF Clone in Cloning Vector, Human HG10616-M
    FGFR1 cDNA ORF Clone, Human, untagged HG29773-UT
    FGFR1 cDNA ORF Clone, Human, untagged HG10616-UT
    FGFR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10616-ACG
    FGFR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10616-ACGLN
    FGFR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10616-ACR
    FGFR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10616-CF
    FGFR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10616-NF
    FGFR1 cDNA ORF Clone, Human, C-His tag HG10616-CH
    FGFR1 cDNA ORF Clone, Human, N-His tag HG10616-NH
    FGFR1 cDNA ORF Clone, Human, C-HA tag HG10616-CY
    FGFR1 cDNA ORF Clone, Human, N-HA tag HG10616-NY
    FGFR1 cDNA ORF Clone, Human, C-Myc tag HG10616-CM
    FGFR1 cDNA ORF Clone, Human, N-Myc tag HG10616-NM
    FGFR1 qPCR Primer Pairs, Human HP100865
    info info
    添加购物车成功! 添加购物车失败!