FGF9 cDNA ORF Clone, Human, untagged

Cat: HG10262-M-N
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FGF9 Reagents
CRO Services

All FGF9 Reagents
FGF9 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
627 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor 9 (glia-activating factor).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 0.63kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FGF9 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF9 cDNA ORF Clone, Human, untagged Alternative Names
FGF-9 cDNA ORF Clone, Human;GAF cDNA ORF Clone, Human;HBFG-9 cDNA ORF Clone, Human;HBGF-9 cDNA ORF Clone, Human;SYNS3 cDNA ORF Clone, Human
FGF9 Background Information

Fibroblast growth factor 9 (FGF9) also known as Glia-activating factor or Heparin-binding growth factor 9, is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. FGF9 plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. FGF9 may have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors.

Full Name
fibroblast growth factor 9
References
  • Giri D, et al. (1999) FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J Cell Physiol. 180(1): 53-60.
  • Schmahl J, et al. (2004) Fgf9 induces proliferation and nuclear localization of FGFR2 in Sertoli precursors during male sex determination. Development. 131(15): 3627-36.
  • Garcès A, et al. (2000) FGF9: a motoneuron survival factor expressed by medial thoracic and sacral motoneurons. J Neurosci Res. 60(1): 1-9.
  • FGF9 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    FGF9 cDNA ORF Clone in Cloning Vector, Canine DG70045-G
    FGF9 cDNA ORF Clone, Canine, untagged DG70045-UT
    FGF9 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70045-ACGLN
    FGF9 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70045-ACG
    FGF9 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70045-ACR
    FGF9 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70045-CF
    FGF9 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70045-NF
    FGF9 cDNA ORF Clone, Canine, C-His tag DG70045-CH
    FGF9 cDNA ORF Clone, Canine, N-His tag DG70045-NH
    FGF9 cDNA ORF Clone, Canine, C-HA tag DG70045-CY
    FGF9 cDNA ORF Clone, Canine, N-HA tag DG70045-NY
    FGF9 cDNA ORF Clone, Canine, C-Myc tag DG70045-CM
    FGF9 cDNA ORF Clone, Canine, N-Myc tag DG70045-NM

    FGF9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FGF9 cDNA ORF Clone in Cloning Vector, Rat RG80143-G
    FGF9 cDNA ORF Clone, Rat, untagged RG80143-UT
    FGF9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80143-ACGLN
    FGF9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80143-ACG
    FGF9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80143-ACR
    FGF9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80143-CF
    FGF9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80143-NF
    FGF9 cDNA ORF Clone, Rat, C-His tag RG80143-CH
    FGF9 cDNA ORF Clone, Rat, N-His tag RG80143-NH
    FGF9 cDNA ORF Clone, Rat, C-HA tag RG80143-CY
    FGF9 cDNA ORF Clone, Rat, N-HA tag RG80143-NY
    FGF9 cDNA ORF Clone, Rat, C-Myc tag RG80143-CM
    FGF9 cDNA ORF Clone, Rat, N-Myc tag RG80143-NM
    FGF9 qPCR Primer Pairs, Rat RP300138

    FGF9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FGF9 cDNA ORF Clone in Cloning Vector, Mouse MG50651-M
    FGF9 cDNA ORF Clone, Mouse, untagged MG50651-UT
    FGF9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50651-ACGLN
    FGF9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50651-ACG
    FGF9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50651-ACR
    FGF9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50651-CF
    FGF9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50651-NF
    FGF9 cDNA ORF Clone, Mouse, C-His tag MG50651-CH
    FGF9 cDNA ORF Clone, Mouse, N-His tag MG50651-NH
    FGF9 cDNA ORF Clone, Mouse, C-HA tag MG50651-CY
    FGF9 cDNA ORF Clone, Mouse, N-HA tag MG50651-NY
    FGF9 cDNA ORF Clone, Mouse, C-Myc tag MG50651-CM
    FGF9 cDNA ORF Clone, Mouse, N-Myc tag MG50651-NM
    FGF9 qPCR Primer Pairs, Mouse MP200630

    FGF9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FGF9 cDNA ORF Clone in Cloning Vector, Human HG10262-M
    FGF9 cDNA ORF Clone, Human, untagged HG10262-UT
    FGF9 cDNA ORF Clone, Human, C-GFPSpark® tag HG10262-ACG
    FGF9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10262-ACGLN
    FGF9 cDNA ORF Clone, Human, C-OFPSpark® tag HG10262-ACR
    FGF9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10262-CF
    FGF9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10262-NF
    FGF9 cDNA ORF Clone, Human, C-His tag HG10262-CH
    FGF9 cDNA ORF Clone, Human, N-His tag HG10262-NH
    FGF9 cDNA ORF Clone, Human, C-HA tag HG10262-CY
    FGF9 cDNA ORF Clone, Human, N-HA tag HG10262-NY
    FGF9 cDNA ORF Clone, Human, C-Myc tag HG10262-CM
    FGF9 cDNA ORF Clone, Human, N-Myc tag HG10262-NM
    FGF9 qPCR Primer Pairs, Human HP100310
    info info
    添加购物车成功! 添加购物车失败!