Quick Order

Text Size:AAA

Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human FCGR2B cDNA Clone Product Information
NCBI RefSeq:NM_001002274.1
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Homo sapiens Fc fragment of IgG, low affinity IIb, receptor (CD32), transcript variant 3 with Flag tag.
Gene Synonym:FCGR2B, CD32, FCG2, CD32B, FCGR2, IGFR2
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-FCGR2B-3-flag
Restriction Site:KpnI + XbaI (5.4kb + 0.93kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 336 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10259-ACG$225
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10259-ACR$225
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10259-CF$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG10259-CH$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10259-CM$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG10259-CY$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone in cloning vectorHG10259-M$75
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10259-M-F$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10259-NF$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG10259-NH$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10259-NM$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG10259-NY$195
Human CD32b/FCGR2B/Fc gamma RIIB transcript variant 3 Gene ORF cDNA clone expression plasmidHG10259-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10259-M-F
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"