Text Size:AAA

Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FANCG/FAGcDNA Clone Product Information
Gene Bank Ref.ID:NM_004629.1
cDNA Size:1869
cDNA Description:ORF Clone of Homo sapiens Fanconi anemia, complementation group G (FANCG) DNA.
Gene Synonym:FAG, XRCC9
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged