Text Size:AAA

Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FANCG/FAGcDNA Clone Product Information
Gene_bank_ref_id:NM_004629.1
cDNA Size:1869
cDNA Description:ORF Clone of Homo sapiens Fanconi anemia, complementation group G (FANCG) DNA.
Gene Synonym:FAG, XRCC9
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10225-ACG$345
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10225-ACR$345
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10225-ANG$345
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10225-ANR$345
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10225-CF$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10225-CH$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10225-CM$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10225-CY$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone)HG10225-M$115
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10225-M-F$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10225-NF$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10225-NH$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10225-NM$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10225-NY$315
Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10225-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10225-M-N
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human FANCG / FAG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"