After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FANCA / FACA Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human FANCA cDNA Clone Product Information
NCBI RefSeq:BC008979
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Homo sapiens Fanconi anemia, complementation group A.
Gene Synonym:FA, FA1, FAA, FAH, FA-H, FACA, FANCH
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-FANCA
Restriction Site:KpnI + XhoI (5.5kb + 0.89kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FANCA Gene Plasmid Map
Human FANCA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human FANCA / FACA Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Background

FANCA is one of the six known Fanconi anemia gene products (FANCA, FANCC, FANCD2, FANCE, FANCF, and FANCG proteins). Fanconi anemia (FA) is a genetic disorder predisposing to aplastic anemia and cancer characterized by hypersensitivity to DNA-damaging agents and oxidative stress. FANCA associates with the IκB kinase (IKK) signalsome via interaction with IKK2. Components of the FANCA complex undergo rapid, stimulus-dependent changes in phosphorylation, which are blocked by kinase-inactive IKK2.

References
  • Otsuki T, et al. (2002) Fanconi anemia protein complex is a novel target of the IKK signalsome. J Cell Biochem. 86 (4): 613-23.
  • Taniguchi T, et al. (2002) The Fanconi anemia protein, FANCE, promotes the nuclear accumulation of FANCC. Blood. 100 (7): 2457-62.
  • Garcia-Higuera I, et al. (1999) Fanconi anemia proteins FANCA, FANCC, and FANCG / XRCC9 interact in a functional nuclear complex. Mol Cell Biol. 19 (7): 4866-73.
  • Size / Price
    Catalog: HG12494-G-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human FANCA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"