Quick Order

DatasheetReviewsRelated ProductsProtocols
Human FABP2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human FABP2 Gene Plasmid Map
Human FABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately 15 kDa, that plays important roles in the transportation and metabolism of long-chain fatty acids. FABP family proteins could be used as tissue specific injury marker based on the following characteristics of FABP. The intestinal fatty acid binding protein (I-FABP), or fatty acid-binding protein 2 (FABP2), an intracellular protein expressed only in the intestine, involved in the absorption and intracellular transport of dietary long chain fatty acids. The FABP2 gene is proposed as a candidate gene for diabetes because the protein it codes is involved in fatty acid (FA) absorption and metabolism. Numerous studies have assessed FABP2 gene variants. A transition of G to A at codon 54 of FABP2 results in an amino acid substitution (Ala54 to Thr54), which is common in diverse populations and results in increased FA absorption in vivo. Some evidence indicates that this variant may be associated with type 2 diabetes. This polymorphism was associated with some cardiovascular risk factors. The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.

References
  • de Luis DA, et al. (2007) Influence of ALA54THR polymorphism of fatty acid-binding protein 2 on obesity and cardiovascular risk factors. Horm Metab Res. 39(11): 830-4.
  • Klapper M, et al.. (2007) The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun. 356(1): 147-52.
  • Contact Us
    Images
    • Human FABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"