ErbB4 cDNA ORF Clone, Human, C-His tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

ErbB4 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3879 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian), transcript variant JM-a/CVT-2 with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
XbaI (5.5kb + 3.91kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ErbB4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ErbB4 cDNA ORF Clone, Human, C-His tag: Validated Images

ErbB4 cDNA ORF Clone, Human, C-His tag: Alternative Names

ALS19 cDNA ORF Clone, Human; HER4 cDNA ORF Clone, Human; p180erbB4 cDNA ORF Clone, Human

ErbB4 Background Information

ERBB4 is a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. ERBB4 is expressed at highest levels in brain, heart, kidney, in addition to skeletal muscle, parathyroid, cerebellum, pituitary, spleen, testis and breast. And lower levels in thymus, lung, salivary gland, and pancreas. It specifically binds to and is activated by neuregulins, NRG-2, NRG-3, heparin-binding EGF-like growth factor, betacellulin and NTAK. ERBB4 also can be activated by other factors and induces a variety of cellular responses including mitogenesis and differentiation. ERBB4 regulates development of the heart, the central nervous system and the mammary gland, gene transcription, cell proliferation, differentiation, migration and apoptosis. It is required for normal cardiac muscle differentiation during embryonic development, and for postnatal cardiomyocyte proliferation. ERBB4 also play a role on the normal development of the embryonic central nervous system, especially for normal neural crest cell migration and normal axon guidance. It is required for mammary gland differentiation, induction of milk proteins and lactation.
Full Name
erb-b2 receptor tyrosine kinase 4
References
  • Huang, Y Z, et al. (2000) Regulation of neuregulin signaling by PSD-95 interacting with ErbB4 at CNS synapses. Neuron. 26(2):443-55.
  • Garcia, R A, et al. (2000) The neuregulin receptor ErbB-4 interacts with PDZ-containing proteins at neuronal synapses. Proc Natl Acad Sci. 97(7):3596-601.
  • Silberberg G, et al. (2006) The involvement of ErbB4 with schizophrenia: association and expression studies. Am J Med Genet. 141(B2):142-8.
  • Sardi SP, et al. (2006) Presenilin-dependent ErbB4 nuclear signaling regulates the timing of astrogenesis in the developing brain. Cell. 127(1):185-97.

ErbB4 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait