Quick Order

Text Size:AAA

Human Ephrin-A5/EFNA5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EphrinA5/EFNA5 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human EphrinA5/EFNA5 Gene Plasmid Map
Human EphrinA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A5/EFNA5 may function actively to stimulate axon fasciculation. The interaction of EFNA5 with EPHA5 also mediates communication between pancreatic islet cells to regulate glucose-stimulated insulin secretion. Ephrin-A5/EFNA5 also serves as a cognate/functional ligand for EPHA7, their interaction regulates brain development modulating cell-cell adhesion and repulsion.

References
  • Frisén J, et al. (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron. 20(2): 235-43.
  • Feldheim DA, et al. (2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of retinocollicular mapping. Neuron. 25(3): 563-74.
  • Wahl S, et al. (2000) Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J Cell Biol. 149(2): 263-70.
  • Contact Us
    Images
    • Human EphrinA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"