Quick Order

Human EphB6/Eph Receptor B6 Gene ORF cDNA clone expression plasmid

  • Human EphB6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human EphB6 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 852 C/T which does not result in any amino acid variation.
( We provide with EphB6 qPCR primers for gene expression analysis, HP100043 )
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Human EphB6 Gene Plasmid Map
Human EphB6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.

  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.