Quick Order

E. coli stx2B / Shiga toxin II subunit B Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
E. coli Shiga toxin II subunit B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1281bp
cDNA Description:Full length Clone DNA of Escherichia coli O104:H4 STX2 gene for Shiga toxin 2 A subunit (stx2A) and Shiga toxin 2 B subunit (stx2B) with C terminal Flag tag.
Gene Synonym:
Species:E. coli
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

E. Coli STX2B is a subunit of Stx2. Stx2, together with Stx1, formed a family of related toxins which are known as shiga toxins. Shiga toxins are mainly produced by the bacteria S. dysenteriae and the Shigatoxigenic group of Escherichia coli, which includes serotypes O157:H7, O104:H4, and other enterohemorrhagic E. coli (EHEC). A total of 3222 outbreak cases (including 39 deaths) have been reported in northern Germany in May through June 2011. The outbreak strain was typed as an enteroaggregative Shiga-toxin–producing E. coli O104:H4, producing extended-spectrum beta-lactamase. The toxin has two subunits—A and B. E. Coli STX2B is the B subunit. It is a pentamer that binds to specific glycolipids on the host cell, specifically globotriaosylceramide. Following this, the A subunit is internalised and cleaved into two parts. Stx2 has been found to be approximately 400 times more toxic (as quantified by LD50 in mice) than Stx-1. The Stx1 and Stx2 B subunits form a pentameric structure that binds to globotriaosylceramidereceptors on eukaryotic cells and promotes endocytosis

References
  • Obata F. et al. (2008) Shiga Toxin 2 Affects the Central Nervous System through Receptor Globotriaosylceramide Localized to Neurons. J Infect Dis. 198 (9): 1398-406.
  • Tironi-Farinati C. et al. (2010) Intracerebroventricular Shiga toxin 2 increases the expression of its receptor globotriaosylceramide and causes dendritic abnormalities. J Neuroimmunol. 222 (1-2): 48-61.
  • Asakura H. et al. (2001) Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol Infect. 127 (1): 27-36.
  • Size / Price
    Catalog: EG40019-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"