Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-His tag

Cat: VG40304-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ebola virus Glycoprotein Reagents
CRO Services
Product recommended

All Ebola virus Glycoprotein Reagents
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
EBOV
NCBI Ref Seq
RefSeq ORF Size
2028 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI (6kb + 2.08kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Ebola virus Glycoprotein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
Ebola virus Glycoprotein Background Information

The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

References
  • Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  • Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  • Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  • Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  • Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.
  • Ebola virus Glycoprotein cDNA ORF Clone, EBOV, Related Products

    Product Name Catalog#(PDF)
    Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized) VG40368-G
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP Gene cDNA clone plasmid VG40537-G
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid (Codon Optimized) VG40304-G
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP Gene cDNA clone plasmid VG40536-G
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized) VG40368-UT
    Ebola virus EBOV (subtype Sudan, strain Gulu) Glycoprotein / GP ORF mammalian expression plasmid (Codon Optimized) VG40094-UT
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein natural ORF mammalian expression plasmid VG40304-UT
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP natural ORF mammalian expression plasmid VG40537-UT
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP natural ORF mammalian expression plasmid VG40536-UT
    Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) Glycoprotein natural ORF mammalian expression plasmid VG40442-UT
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40537-ACGLN
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-GFPSpark tag VG40537-ACG
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-GFPSpark tag VG40536-ACG
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-GFPSpark tag VG40304-ACG
    Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40368-ACGLN
    Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) Glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40442-ACGLN
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40304-ACGLN
    Ebola virus EBOV (subtype Sudan, strain Gulu) Glycoprotein / GP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40094-ACGLN
    Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40368-ACG
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40536-ACGLN
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-GFPSpark tag VG40537-ANG
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-GFPSpark tag VG40536-ANG
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-GFPSpark tag VG40304-ANG
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40537-ACR
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40536-ACR
    Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40368-ACR
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40304-ACR
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40537-ANR
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40304-ANR
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40536-ANR
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40368-CF
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-Flag tag VG40304-CF
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-Flag tag VG40536-CF
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-Flag tag VG40537-CF
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-Flag tag VG40537-NF
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-Flag tag VG40304-NF
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40368-NF
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-Flag tag VG40536-NF
    Ebola virus EBOV (subtype Bundibugyo, strain Bundibugyo 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40368-CH
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-His tag VG40536-CH
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-His tag VG40537-CH
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-His tag VG40304-CH
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-His tag VG40536-NH
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40368-NH
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-His tag VG40537-NH
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40368-CY
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-HA tag VG40537-CY
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-HA tag VG40304-CY
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-HA tag VG40536-CY
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, N-HA tag VG40304-NY
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-HA tag VG40536-NY
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-HA tag VG40537-NY
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40368-NY
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40368-CM
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-Myc tag VG40536-CM
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, C-Myc tag VG40537-CM
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein ORF mammalian expression plasmid, C-Myc tag VG40304-CM
    Ebola virus EBOV (subtype Bundibugyo, strain Uganda 2007) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40368-NM
    Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40304-NM
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-Myc tag VG40536-NM
    Ebola virus EBOV (subtype Tai Forest, strain Cote d'Ivoire-94) spike glycoprotein precursor / GP ORF mammalian expression plasmid, N-Myc tag VG40537-NM
    info info
    添加购物车成功! 添加购物车失败!