Quick Order

Text Size:AAA

Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBOV EBOV-L cDNA Clone Product Information
Gene_bank_ref_id:KJ660346.1(nt 11581-12930)
RefSeq ORF Size:1350bp
cDNA Description:Full length Clone DNA of Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L with N terminal HA tag.
Gene Synonym:EBOV-L
Species:EBOV
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-HA tag on other vectors
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial, ORF mammalian expression plasmid, C-Flag tagVG40450-ACG$325
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40450-ACR$325
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial (Codon Optimized) ORF mammalian expression plasmid, C-Flag tagVG40450-CF$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, C-His tagVG40450-CH$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, C-Myc tagVG40450-CM$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, C-HA tagVG40450-CY$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial natural ORF mammalian expression plasmidVG40450-G$95
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-Flag tagVG40450-NF$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-His tagVG40450-NH$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-Myc tagVG40450-NM$295
Ebola virus EBOV (Subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) RNA polymerase L partial ORF mammalian expression plasmid, N-HA tagVG40450-NY$295
Ebola virus EBOV (subtype Zaire, Guinea 2014) RNA polymerase L partial natural ORF mammalian expression plasmidVG40450-UT$295
 Learn more about expression Vectors
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"