Text Size:AAA

Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    EBOV EBOV-G cDNA Clone Product Information
    NCBI RefSeq:NC_004161.1
    RefSeq ORF Size:2034bp
    cDNA Description:Full length Clone DNA of Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein with N terminal His tag.
    Gene Synonym:EBOV-G
    Species:EBOV
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-His tag on other vectors
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-GFPSpark tagVG40536-ACG$345
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40536-ACR$345
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-GFPSpark tagVG40536-ANG$345
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40536-ANR$345
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-Flag tagVG40536-CF$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-His tagVG40536-CH$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-Myc tagVG40536-CM$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, C-HA tagVG40536-CY$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP Gene cDNA clone plasmidVG40536-G$115
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-Flag tagVG40536-NF$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-His tagVG40536-NH$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-Myc tagVG40536-NM$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP ORF mammalian expression plasmid, N-HA tagVG40536-NY$315
    Ebola virus EBOV (subtype Reston, strain Pennsylvania or Reston-89) structural glycoprotein / GP natural ORF mammalian expression plasmidVG40536-UT$315
     Learn more about expression Vectors
    Product nameProduct name
    Background

    The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

    References
    1. Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
    2. Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
    3. Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
    4. Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
    5. Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.
    Size / Price
    Catalog: VG40536-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"