Text Size:AAA

Human ESR2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESR2cDNA Clone Product Information
Gene Bank Ref.ID:NM_001437.2
cDNA Size:1593
cDNA Description:ORF Clone of Homo sapiens estrogen receptor 2 (ER beta) DNA.
Gene Synonym:Erb, ESRB, ESTRB, NR3A2, ER-BETA, ESR-BETA, ESR2
Species:Human
Vector:pCMV2-FLAG
Restriction Site:HindIII + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Related Products
Product nameProduct name
Catalog:HG11302-M-F
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
Images
  • Human ESR2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"