Text Size:AAA

Human ESR2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESR2cDNA Clone Product Information
Gene_bank_ref_id:NM_001437.2
RefSeq ORF Size:1593bp
cDNA Description:Full length Clone DNA of Homo sapiens estrogen receptor 2 (ER beta) with Flag tag.
Gene Synonym:Erb, ESRB, ESTRB, NR3A2, ER-BETA, ESR-BETA, ESR2
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-ESR2-flag
Restriction Site:HindIII + XhoI (5.4kb + 1.64kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Images
Human ESR2 natural ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Other ESR2 Protein Products
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"