Text Size:AAA

Human ESR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESR2cDNA Clone Product Information
Gene Bank Ref.ID:NM_001437.2
cDNA Size:1593
cDNA Description:ORF Clone of Homo sapiens estrogen receptor 2 (ER beta) DNA.
Gene Synonym:Erb, ESRB, ESTRB, NR3A2, ER-BETA, ESR-BETA, ESR2
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human ESR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

pCMV/hygro vector information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background
References
Catalog:HG11302-M-N
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
5 business days
Images
  • Human ESR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"