Text Size:AAA

Human ESR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ESR1cDNA Clone Product Information
Gene Bank Ref.ID:NM_001122742.1
cDNA Size:1788
cDNA Description:ORF Clone of Homo sapiens estrogen receptor 1 DNA.
Gene Synonym:ER, ESR, Era, ESRA, NR3A1, DKFZp686N23123, ESR1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 30 T/C not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
List Price: $395.00  (Save $80.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human ESR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged