Text Size:AAA

Mouse ERBB3 partial Gene cDNA Clone / ORF Clone, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ErbB3/HER3cDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1975
cDNA Description:ORF Clone of Mus musculus v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) DNA.This cDNA clone has gone through customized codon optimization in order to obtain high level of protein expression in particular cell lines. Therefore, although the translated amino acid sequence is identical to the amino sequence on Gene Bank, the DNA sequence is different from that on Gene Bank.
Gene Synonym:Her3, C76256, Erbb-3, Erbb3r
Species:Mouse
Vector:Vector 3
Restriction Site:HindIII + XbaI
Tag Sequence:His Tag Sequence: CATCACCACCATCACCACCATCATCACCAT
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Vector 3 Information

The Vector 3 is 5.4kb in length, and contains the the amplicin resistance gene, conferring selection of the plasmid in E. coli., the kanamycin resistance gene (neomycin for mammalian selection), and the CMV promoter upstream of the cDNA insert. The SV40 origin allows for replication in mammalian cells, the ColE1 origin is the bacterial origin of replication, and the f1 origin is the filamentous phage origin of replication. The plasmid has multiple cloning sites as shown below. NOTE: the restriction enzymes used in each vector 3 clone is indicated in the product datasheet.

Vector 3 Usage Suggestion

The coding sequence can be easily obtained by digesting the vector with proper restriction enzyme(s). The coding sequence can also be amplified by PCR with primer pair SP6 and T7.

Vector Sequence Download
Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinCynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinRat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Human BTC / Betacellulin Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag) Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human Amphiregulin / AREG ProteinHuman / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)
Background

ErbB3, also known as Her3(human epidermal growth factor receptor3), is a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound glycoprotein has a neuregulin binding domain but has not an active kinase domain., and therefore can not mediate the intracellular signal transduction through protein phosphorylation. However, its heterodimer with ErbB2 or other EGFR members responsible for tyrosine phosphorylation forms a receptor complex with high affinity, and initiates the related pathway which lead to cell proliferation or differentiation. ErbB3 has been shown to implicated in numerous cancers, including prostate, bladder, and breast tumors. This protein has different isoforms derived from alternative splicing variants, and among which, the secreted isoform lacking the intermembrane region modulates the activity of membrane-bound form.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"