_×
Human EPYC Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human EPYC Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

Human EPYC Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG13855-G-H
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

EPYC cDNA Clone Datasheet

 

EPYC cDNA Clone Product Information

Gene Bank Ref.ID:

BC030958

cDNA Size:

969

Gene Synonym:

DSPG3, PGLB, Pg-Lb, SLRR3B,EPYC

Source: Human

EPYC cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens epiphycan DNA.

Vector:

pCMV/hygro-His

His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description: Identical with the Gene Bank Ref.ID sequence.

EPYC cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

EPYC cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

EPYC cDNA Clone Sequence and Quality Control

Sequence:

1        ATGAAGACAT TAGCAGGACT TGTTCTGGGA CTTGTCATCT TTGATGCTGC TGTGACTGCC
61       CCAACTCTAG AGTCCATCAA CTATGACTCA GAAACCTATG ATGCCACCTT AGAAGACCTG
121      GATAATTTGT ACAACTATGA AAACATACCT GTTGGTAAAG TTGAGATTGA AATAGCCACA
181      GTGATGCCTT CAGGGAACAG AGAGCTCCTC ACTCCACCCC CACAGCCTGA GAAGGCCCAG
241      GAAGAGGAAG AGGAGGAGGA ATCTACTCCC AGGCTGATTG ATGGCTCTTC TCCCCAGGAG
301      CCTGAATTCA CAGGGGTTCT GGGGCCACAC ACAAATGAAG ACTTTCCAAC CTGTCTTTTG
361      TGTACTTGTA TAAGTACCAC CGTGTACTGT GATGACCATG AACTTGATGC TATTCCTCCG
421      CTGCCAAAGA ACACCGCTTA TTTCTATTCC CGCTTTAACA GAATTAAAAA GATCAACAAA
481      AATGACTTTG CAAGCCTAAG TGATTTAAAA AGGATTGATC TGACATCAAA TTTAATATCT
541      GAGATTGATG AAGATGCATT CCGAAAACTG CCTCAACTTC GAGAGCTTGT CCTGCGTGAC
601      AACAAAATAA GGCAGCTCCC AGAATTGCCA ACCACTTTGA CATTTATTGA TATTAGCAAC
661      AATAGACTTG GAAGGAAAGG GATAAAGCAA GAAGCATTTA AAGACATGTA TGATCTCCAT
721      CATCTGTACC TCACTGATAA CAACTTGGAC CACATCCCTC TGCCACTCCC AGAAAATCTA
781      CGAGCCCTTC ACCTCCAGAA TAACAACATT CTGGAAATGC ACGAAGATAC GTTCTGCAAT
841      GTTAAAAATT TGACTTATAT TCGTAAGGCA CTAGAGGACA TTCGATTGGA TGGAAACCCT
901      ATTAATCTCA GCAAAACTCC TCAAGCATAC ATGTGTCTAC CTCGTCTGCC TGTTGGGAGC
961      CTTGTCGCT1C ACCATCACCA CCATCATCAC CACCATCAC2T AA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. His Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"