Quick Order

Human PKR Gene ORF cDNA clone expression plasmid

  • Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human PKR cDNA Clone Product Information
NCBI RefSeq:NM_002759.1
RefSeq ORF Size:1656bp
cDNA Description:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2-alpha, kinase 2.
Gene Synonym:EIF2AK2, PKR, PRKR, EIF2AK1, MGC126524
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-EIF2AK2
Restriction Site:KpnI + XhoI (5.5kb + 1.66kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EIF2AK2 qPCR primers for gene expression analysis, HP100166 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PKR Gene Plasmid Map
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"