Quick Order

Canine EGFR/HER1 Gene ORF cDNA clone expression plasmid, C-His tag

  • Canine EGFR Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
DatasheetReviewsRelated ProductsProtocols
Canine EGFR/ErbB1/HER1 cDNA Clone Product Information
NCBI RefSeq:XM_533073.3
RefSeq ORF Size:3543bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris epidermal growth factor receptor with His tag.
Gene Synonym:EGFR
Restriction Site:KpnI + XhoI (5.5kb + 3.57kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Canine EGFR/ErbB1/HER1 Gene Plasmid Map
Canine EGFR Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • Size / Price
    Catalog: DG70026-G-H
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.