After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EDA-A1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human EDA-A1 Gene Plasmid Map
Human EDA-A1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10191-ACG$225
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10191-ACR$225
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10191-CF$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10191-CH$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10191-CM$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10191-CY$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10191-M$75
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10191-M-F$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10191-NF$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10191-NH$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10191-NM$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10191-NY$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10191-UT$195
 Learn more about expression Vectors
Product nameProduct name
Contact Us
Images
  • Human EDA-A1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"