Quick Order

Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EDA-A1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human EDA-A1 Gene Plasmid Map
Human EDA-A1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10191-ACG$225
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10191-ACR$225
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10191-CF$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10191-CH$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10191-CM$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10191-CY$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10191-M$75
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10191-M-F$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10191-NF$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10191-NH$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10191-NM$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10191-NY$195
Human EDA-A1/Ectodysplasin-A1 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10191-UT$195
 Learn more about expression Vectors
Product nameProduct name
Contact Us
  • Human EDA-A1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.