After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human EBI3 / IL27b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EBI3 cDNA Clone Product Information
NCBI RefSeq:NM_005755.2
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Homo sapiens Epstein-Barr virus induced 3 (EBI3).
Gene Synonym:IL27B, EBI3
Restriction Site:HindIII + XhoI (5.5kb + 0.69kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human EBI3 Gene Plasmid Map
Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The novel Ebi3-IL-12alpha heterodimeric cytokine has been designated interleukin-35 (IL-35), is a member IL12 family cytokine produced by regulatory T cells (Treg), but not by resting or activated effector T cells (Teff). IL-35 is a heterodimeric protein composed of IL-12α (P35) and IL-27β chains, which are encoded by two separate genes called IL12A and EBI3 (Epstein-Barr-virus-induced gene 3) respectively. Ectopic expression of IL-35 confers regulatory activity on naive T cells, whereas recombinant IL-35 suppresses T-cell proliferation. It identify IL-35 as a novel inhibitory cytokine that may be specifically produced by T(reg) cells and is required for maximal suppressive activity. IL-35 has biological activity and able to expand CD4+CD25+ Treg cells, suppress the proliferation of CD4+CD25- effector cells and inhibit Th17 cell polarization. IL-35 has been shown to be constitutively expressed by regulatory T (Treg) cells CD4(+)CD25(+)Foxp3(+) and suggested to contribute to their suppressive activity. IL-35 is a crucial mediator which provokes CD4+CD25+ T cell proliferation and IL-10 generation, another well-known anti-inflammatory cytokine, along with TGFbeta cytokine. IL-35 is a cytokine can downregulate Th17 cell development and inhibit autoimmune inflammation. It inhibited the differentiation of Th17 cells in vitro. In vivo, IL-35 effectively attenuated established collagen-induced arthritis in mice, with concomitant suppression of IL-17 production but enhanced IFN-gamma synthesis. Thus, IL-35 is a novel anti-inflammatory cytokine suppressing the immune response through the expansion of regulatory T cells and suppression of Th17 cell development.

  • Niedbala W, et al. (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37(11): 3021-9.
  • Collison LW, et al. (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 450(7169): 566-9.
  • Castellani ML, et al. (2010) IL-35, an anti-inflammatory cytokine which expands CD4+CD25+ Treg Cells. J Biol Regul Homeost Agents. 24(2): 131-5.
  • Kochetkova I, et al. (2010) IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol. 184(12): 7144-53.
  • Seyerl M, et al. (2010) Human rhinoviruses induce IL-35-producing Treg via induction of B7-H1 (CD274) and sialoadhesin (CD169) on DC. Eur J Immunol. 40(2): 321-9.
  • Size / Price
    Catalog: HG10117-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.