Quick Order

Human EBI3 / IL27b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human EBI3 cDNA Clone Product Information
NCBI RefSeq:NM_005755.2
RefSeq ORF Size:690bp
cDNA Description:Full length Clone DNA of Homo sapiens Epstein-Barr virus induced 3 (EBI3).
Gene Synonym:IL27B, EBI3
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-IL27B
Restriction Site:HindIII + XhoI (5.5kb + 0.69kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human EBI3 Gene Plasmid Map
Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The novel Ebi3-IL-12alpha heterodimeric cytokine has been designated interleukin-35 (IL-35), is a member IL12 family cytokine produced by regulatory T cells (Treg), but not by resting or activated effector T cells (Teff). IL-35 is a heterodimeric protein composed of IL-12α (P35) and IL-27β chains, which are encoded by two separate genes called IL12A and EBI3 (Epstein-Barr-virus-induced gene 3) respectively. Ectopic expression of IL-35 confers regulatory activity on naive T cells, whereas recombinant IL-35 suppresses T-cell proliferation. It identify IL-35 as a novel inhibitory cytokine that may be specifically produced by T(reg) cells and is required for maximal suppressive activity. IL-35 has biological activity and able to expand CD4+CD25+ Treg cells, suppress the proliferation of CD4+CD25- effector cells and inhibit Th17 cell polarization. IL-35 has been shown to be constitutively expressed by regulatory T (Treg) cells CD4(+)CD25(+)Foxp3(+) and suggested to contribute to their suppressive activity. IL-35 is a crucial mediator which provokes CD4+CD25+ T cell proliferation and IL-10 generation, another well-known anti-inflammatory cytokine, along with TGFbeta cytokine. IL-35 is a cytokine can downregulate Th17 cell development and inhibit autoimmune inflammation. It inhibited the differentiation of Th17 cells in vitro. In vivo, IL-35 effectively attenuated established collagen-induced arthritis in mice, with concomitant suppression of IL-17 production but enhanced IFN-gamma synthesis. Thus, IL-35 is a novel anti-inflammatory cytokine suppressing the immune response through the expansion of regulatory T cells and suppression of Th17 cell development.

References
  • Niedbala W, et al. (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37(11): 3021-9.
  • Collison LW, et al. (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 450(7169): 566-9.
  • Castellani ML, et al. (2010) IL-35, an anti-inflammatory cytokine which expands CD4+CD25+ Treg Cells. J Biol Regul Homeost Agents. 24(2): 131-5.
  • Kochetkova I, et al. (2010) IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol. 184(12): 7144-53.
  • Seyerl M, et al. (2010) Human rhinoviruses induce IL-35-producing Treg via induction of B7-H1 (CD274) and sialoadhesin (CD169) on DC. Eur J Immunol. 40(2): 321-9.
  • Size / Price
    Catalog: HG10117-M-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"