Quick Order

Text Size:AAA

E. coli Enoyl-ACP Reductase/FABI Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    E. coli FABI cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:789bp
    cDNA Description:Full length Clone DNA of Escherichia coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent with C terminal Flag tag.
    Gene Synonym:envM
    Species:E. coli
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

    References
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • Size / Price
    Catalog: EG30001-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"