Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CDH1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human CDH1 Gene Plasmid Map
Human E-Cadherin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

References
  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Images
    • Human E-Cadherin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"