Quick Order

Human DKK1/Dkk-1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human DKK1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Storage:
Human DKK1 Gene Plasmid Map
Human Dkk1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

References
  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • Contact Us
    Images
    • Human Dkk1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"