DKK1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10170-M-M
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DKK1 Reagents
CRO Services

All DKK1 Reagents
DKK1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human dickkopf homolog 1 (Xenopus laevis) with Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-Myc
Restriction Sites
KpnI + XhoI (5.5kb + 0.83kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
DKK1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DKK1 cDNA ORF Clone, Human, C-Myc tag Validated Images
Human DKK1/Dkk-1 Gene Plasmid Map 7203
DKK1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
DKK-1 cDNA ORF Clone, Human;SK cDNA ORF Clone, Human
DKK1 Background Information

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

Full Name
dickkopf WNT signaling pathway inhibitor 1
References
  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • DKK1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    DKK1 cDNA ORF Clone, Mouse, untagged MG57248-UT
    DKK1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57248-ACG
    DKK1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57248-ACGLN
    DKK1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57248-ACR
    DKK1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57248-CF
    DKK1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57248-NF
    DKK1 cDNA ORF Clone, Mouse, C-His tag MG57248-CH
    DKK1 cDNA ORF Clone, Mouse, N-His tag MG57248-NH
    DKK1 cDNA ORF Clone, Mouse, C-HA tag MG57248-CY
    DKK1 cDNA ORF Clone, Mouse, N-HA tag MG57248-NY
    DKK1 cDNA ORF Clone, Mouse, C-Myc tag MG57248-CM
    DKK1 cDNA ORF Clone, Mouse, N-Myc tag MG57248-NM

    DKK1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    DKK1 cDNA ORF Clone in Cloning Vector, Human HG10170-M
    DKK1 cDNA ORF Clone, Human, untagged HG10170-UT
    DKK1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10170-ACG
    DKK1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10170-ACGLN
    DKK1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10170-ACR
    DKK1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10170-CF
    DKK1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10170-NF
    DKK1 cDNA ORF Clone, Human, C-His tag HG10170-CH
    DKK1 cDNA ORF Clone, Human, N-His tag HG10170-NH
    DKK1 cDNA ORF Clone, Human, C-HA tag HG10170-CY
    DKK1 cDNA ORF Clone, Human, N-HA tag HG10170-NY
    DKK1 cDNA ORF Clone, Human, C-Myc tag HG10170-CM
    DKK1 cDNA ORF Clone, Human, N-Myc tag HG10170-NM
    DKK1 qPCR Primer Pairs, Human HP100238
    info info
    添加购物车成功! 添加购物车失败!